WWW.LI.I-DOCX.RU
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - Различные ресурсы
 

Pages:     | 1 |   ...   | 12 | 13 || 15 | 16 |   ...   | 17 |

«Антипролиферативное действие карнозина и его производных на опухолевые клетки нейрального происхождения ...»

-- [ Страница 14 ] --

bCBQcm9saWZlcmF0aW9uPC9rZXl3b3JkPjxrZXl3b3JkPkNlbGxzLCBDdWx0dXJlZDwva2V5d29y

ZD48a2V5d29yZD5DeWNsaW4gQi9tZXRhYm9saXNtPC9rZXl3b3JkPjxrZXl3b3JkPkN5Y2xpbiBC

MTwva2V5d29yZD48a2V5d29yZD5DeWNsaW4gRDEvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29y

ZD5GaWJyb2JsYXN0cy9jeXRvbG9neS9tZXRhYm9saXNtPC9rZXl3b3JkPjxrZXl3b3JkPkh1bWFu

czwva2V5d29yZD48a2V5d29yZD5IeWRyb2dlbiBQZXJveGlkZS9hbmFseXNpczwva2V5d29yZD48

a2V5d29yZD5SZWFjdGl2ZSBPeHlnZW4gU3BlY2llcy9hbmFseXNpcy9tZXRhYm9saXNtPC9rZXl3

b3JkPjxrZXl3b3JkPlN1cGVyb3hpZGUgRGlzbXV0YXNlL2RlZmljaWVuY3kvIG1ldGFib2xpc208

L2tleXdvcmQ+PGtleXdvcmQ+U3VwZXJveGlkZXMvYW5hbHlzaXMvbWV0YWJvbGlzbTwva2V5d29y

ZD48L2tleXdvcmRzPjxkYXRlcz48eWVhcj4yMDA4PC95ZWFyPjxwdWItZGF0ZXM+PGRhdGU+SnVu

PC9kYXRlPjwvcHViLWRhdGVzPjwvZGF0ZXM+PGlzYm4+MTQ3NC05NzI2IChFbGVjdHJvbmljKSYj

eEQ7MTQ3NC05NzE4IChMaW5raW5nKTwvaXNibj48YWNjZXNzaW9uLW51bT4xODMzMTYxNzwvYWNj

ZXNzaW9uLW51bT48dXJscz48L3VybHM+PGN1c3RvbTI+UE1DMjUzODk0NTwvY3VzdG9tMj48Y3Vz

dG9tNj5OaWhtczU5MzczPC9jdXN0b202PjxlbGVjdHJvbmljLXJlc291cmNlLW51bT4xMC4xMTEx

L2ouMTQ3NC05NzI2LjIwMDguMDAzODQueDwvZWxlY3Ryb25pYy1yZXNvdXJjZS1udW0+PHJlbW90

ZS1kYXRhYmFzZS1wcm92aWRlcj5OTE08L3JlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj48bGFuZ3Vh

Z2U+ZW5nPC9sYW5ndWFnZT48L3JlY29yZD48L0NpdGU+PC9FbmROb3RlPgB=

ADDIN EN.CITE.DATA [66, 256]. Гель инкубировали 20 мин при tкомн в окрашивающей смеси, содержащей 2,43 мМ нитросиний тетразолий, 2,8105 M рибофлавин и 28 мМ ТЕМЕД, и проявляли на свету до появления прозрачных полос. Метод основан на том, что на свету рибофлавин образует супероксид, который превращает нитросиний тетразолий из желтого в темно синий, что окрашивает гель. Поскольку MnСОД катализирует реакцию дисмутации супероксида, то MnСОД-содержащие полоски становятся прозрачными. Проявленный гель сканировали с помощью Epson Perfection 4990 PHOTO (Epson, США) и анализировали насыщенность полос в программе ImageJ (NIH, США).



2.7. Определение активности каталазыБелок выделяли по методу, описанному выше (Раздел 2.5). Активность каталазы определяли биохимическим путем на спектрофотометре по скорости деградации пероксида водорода по методу, предложенному Aebi и соавторами ADDIN EN.CITE <EndNote><Cite><Author>Aebi</Author><Year>1984</Year><RecNum>138</RecNum><DisplayText>[257]</DisplayText><record><rec-number>138</rec-number><foreign-keys><key app="EN" db-id="w2wfxafe6va9z5eev2l55aa8sxsa599eev2s">138</key></foreign-keys><ref-type name="Journal Article">17</ref-type><contributors><authors><author>Aebi, H.</author></authors></contributors><titles><title>Catalase in vitro</title><secondary-title>Methods Enzymol</secondary-title><alt-title>Methods in enzymology</alt-title></titles><periodical><full-title>Methods Enzymol</full-title><abbr-1>Methods in enzymology</abbr-1></periodical><alt-periodical><full-title>Methods Enzymol</full-title><abbr-1>Methods in enzymology</abbr-1></alt-periodical><pages>121-6</pages><volume>105</volume><edition>1984/01/01</edition><keywords><keyword>Animals</keyword><keyword>Catalase/blood/ metabolism</keyword><keyword>Humans</keyword><keyword>Hydrogen Peroxide/metabolism</keyword><keyword>Kidney/enzymology</keyword><keyword>Kinetics</keyword><keyword>Liver/enzymology</keyword><keyword>Protein Binding</keyword><keyword>Spectrophotometry, Ultraviolet/methods</keyword><keyword>Tissue Distribution</keyword></keywords><dates><year>1984</year></dates><isbn>0076-6879 (Print)&#xD;0076-6879 (Linking)</isbn><accession-num>6727660</accession-num><urls></urls><remote-database-provider>NLM</remote-database-provider><language>eng</language></record></Cite></EndNote>[257]. Принцип метода основан на том, что активность каталазы рассчитывается исходя из скорости распада Н2О2. В кювете смешивали известные количества образца и Н2О2 и измеряли оптическую плотность при 240 нМ. Поскольку каталаза разрушает Н2О2, то чем выше была активность каталазы в образце, тем быстрее снижалась концентрация Н2О2 в кювете.

2.8. Полимеразная цепная реакция (ПЦР) в реальном времениКлетки лизировали в тризоле и затем выделяли РНК с помощью набора «Direct-zolTM RNA MiniPrep Kit» согласно инструкции производителя (Zimo Research Corp., США). Комплементарную ДНК (кДНК) синтезировали с помощью набора «High Capacity cDNA Reverse Transcription Kit» (Applied Biosystems, США). Количественную ПЦР в режиме реального времени (45 циклов) проводили на приборе StepOne™ System (Applied Biosystems, США) с использованием красителя SYBR Green и праймеров. Последовательности праймеров представленных в Таблице 1. Данные анализировали в программе StepOne™ Software v2.2 (Applied Biosystems, США) и Microsoft Excel (Microsoft, США). Результаты представлены в виде относительных значений экспрессии (2Ct), где Ct - значение порогового цикла реакции.

2.9. Статистическая обработка результатовРезультаты измерений, проведенных в 3-5 параллельных пробах, представлены в виде «среднее значение ± стандартное отклонение». Статистическая значимость определяли с помощью одномерного дисперсионного анализа с последующим тестом на наименьшую значимую разность и тестом на взвешенное среднее Тьюки. Данные тесты используются для сравнения и определения разницы между и в пределах групп данных в зависимости от значений среднего и среднеквадратических ошибок для каждой переменной. Гомогенность дисперсии бралась в пределах доверительного интервала в 95%. Результаты со значениями P<0.05 принимались как статистически значимые.

Таблица 1. Последовательности праймеров для ПЦР в реальном времени.

Ген Gene Bank No. Последовательность (5’ 3’) Размер ампликона (п.о.)

CCNB1

(циклин В1) NM_031966.3 Forward: TAGCACTGAAAATTCTGGATAATGGTGA

Reverse: TTGATTTACCATGACTACATTCTTAGCCAG 125

ACTB

(актин В) NM_001101.3 Forward:

TCACCATTGGCAATGAGCGGTT

Reverse:

AGTTTCGTGGATGCCACAGGACT 89

CRNS1

(карнозин-синтетаза) NM_001166222.1

Forward:

AAGCTGGAGGAGGAGGAGAGTGTC

Reverse:

CCTTGCTCAGCAGTGGCCTATCA 154

CNDP1

(карнозиназа) NM_032649 Forward:

CAGCAATCACTTACGGAACCCG

Resverse:

CCGAGAAGAGCAACCAGATCAGC 133

MnСОД NM_000636.2 Forward:

TTGGCCAAGGGAGATGTTAC

Reverse:

AGTCACGTTTGATGGCTTCC 157

ГЛАВА 3. РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯРАЗДЕЛ 3.

1. Изучение характера действия карнозина и его производных на опухолевые клеткиАнтипролиферативный эффект карнозина на опухолевые и трансформированные клетки был продемонстрирован на ряде различных моделей PEVuZE5vdGU+PENpdGU+PEF1dGhvcj5OYWdhaTwvQXV0aG9yPjxZZWFyPjE5ODY8L1llYXI+PFJl

Y051bT44ODwvUmVjTnVtPjxEaXNwbGF5VGV4dD5bMjAsIDIxLCAyMywgMjA4XTwvRGlzcGxheVRl

eHQ+PHJlY29yZD48cmVjLW51bWJlcj44ODwvcmVjLW51bWJlcj48Zm9yZWlnbi1rZXlzPjxrZXkg

YXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZlNnZhOXo1ZWV2Mmw1NWFhOHN4c2E1OTllZXYycyI+ODg8

L2tleT48L2ZvcmVpZ24ta2V5cz48cmVmLXR5cGUgbmFtZT0iSm91cm5hbCBBcnRpY2xlIj4xNzwv

cmVmLXR5cGU+PGNvbnRyaWJ1dG9ycz48YXV0aG9ycz48YXV0aG9yPk5hZ2FpLCBLLjwvYXV0aG9y

PjxhdXRob3I+U3VkYSwgVC48L2F1dGhvcj48L2F1dGhvcnM+PC9jb250cmlidXRvcnM+PHRpdGxl

cz48dGl0bGU+W0FudGluZW9wbGFzdGljIGVmZmVjdHMgb2YgY2Fybm9zaW5lIGFuZCBiZXRhLWFs

YW5pbmUtLXBoeXNpb2xvZ2ljYWwgY29uc2lkZXJhdGlvbnMgb2YgaXRzIGFudGluZW9wbGFzdGlj

IGVmZmVjdHNdPC90aXRsZT48c2Vjb25kYXJ5LXRpdGxlPk5paG9uIFNlaXJpZ2FrdSBaYXNzaGk8

L3NlY29uZGFyeS10aXRsZT48YWx0LXRpdGxlPk5paG9uIHNlaXJpZ2FrdSB6YXNzaGkuIEpvdXJu

YWwgb2YgdGhlIFBoeXNpb2xvZ2ljYWwgU29jaWV0eSBvZiBKYXBhbjwvYWx0LXRpdGxlPjwvdGl0

bGVzPjxwZXJpb2RpY2FsPjxmdWxsLXRpdGxlPk5paG9uIFNlaXJpZ2FrdSBaYXNzaGk8L2Z1bGwt

dGl0bGU+PGFiYnItMT5OaWhvbiBzZWlyaWdha3UgemFzc2hpLiBKb3VybmFsIG9mIHRoZSBQaHlz

aW9sb2dpY2FsIFNvY2lldHkgb2YgSmFwYW48L2FiYnItMT48L3BlcmlvZGljYWw+PGFsdC1wZXJp

b2RpY2FsPjxmdWxsLXRpdGxlPk5paG9uIFNlaXJpZ2FrdSBaYXNzaGk8L2Z1bGwtdGl0bGU+PGFi

YnItMT5OaWhvbiBzZWlyaWdha3UgemFzc2hpLiBKb3VybmFsIG9mIHRoZSBQaHlzaW9sb2dpY2Fs

IFNvY2lldHkgb2YgSmFwYW48L2FiYnItMT48L2FsdC1wZXJpb2RpY2FsPjxwYWdlcz43NDEtNzwv

cGFnZXM+PHZvbHVtZT40ODwvdm9sdW1lPjxudW1iZXI+MTE8L251bWJlcj48ZWRpdGlvbj4xOTg2

LzAxLzAxPC9lZGl0aW9uPjxrZXl3b3Jkcz48a2V5d29yZD5BbGFuaW5lLyBwaGFybWFjb2xvZ3k8

L2tleXdvcmQ+PGtleXdvcmQ+QW5pbWFsczwva2V5d29yZD48a2V5d29yZD5BbnRpbmVvcGxhc3Rp

YyBBZ2VudHM8L2tleXdvcmQ+PGtleXdvcmQ+Q2Fybm9zaW5lL2FkbWluaXN0cmF0aW9uICZhbXA7

IGRvc2FnZS8gcGhhcm1hY29sb2d5L3RoZXJhcGV1dGljIHVzZTwva2V5d29yZD48a2V5d29yZD5E

aXBlcHRpZGVzLyBwaGFybWFjb2xvZ3k8L2tleXdvcmQ+PGtleXdvcmQ+TWFsZTwva2V5d29yZD48

a2V5d29yZD5NaWNlPC9rZXl3b3JkPjxrZXl3b3JkPk1pdG9teWNpbjwva2V5d29yZD48a2V5d29y

ZD5NaXRvbXljaW5zL2FkbWluaXN0cmF0aW9uICZhbXA7IGRvc2FnZTwva2V5d29yZD48a2V5d29y

ZD5QaWNpYmFuaWwvYWRtaW5pc3RyYXRpb24gJmFtcDsgZG9zYWdlPC9rZXl3b3JkPjxrZXl3b3Jk

PlNhcmNvbWEgMTgwL2RydWcgdGhlcmFweTwva2V5d29yZD48a2V5d29yZD5iZXRhLUFsYW5pbmUv

YWRtaW5pc3RyYXRpb24gJmFtcDsgZG9zYWdlLyBwaGFybWFjb2xvZ3kvdGhlcmFwZXV0aWMgdXNl

PC9rZXl3b3JkPjwva2V5d29yZHM+PGRhdGVzPjx5ZWFyPjE5ODY8L3llYXI+PC9kYXRlcz48aXNi

bj4wMDMxLTkzNDEgKFByaW50KSYjeEQ7MDAzMS05MzQxIChMaW5raW5nKTwvaXNibj48YWNjZXNz

aW9uLW51bT4zMTAyNzIxPC9hY2Nlc3Npb24tbnVtPjx1cmxzPjwvdXJscz48cmVtb3RlLWRhdGFi

YXNlLXByb3ZpZGVyPk5MTTwvcmVtb3RlLWRhdGFiYXNlLXByb3ZpZGVyPjxsYW5ndWFnZT5qcG48

L2xhbmd1YWdlPjwvcmVjb3JkPjwvQ2l0ZT48Q2l0ZT48QXV0aG9yPkhvbGxpZGF5PC9BdXRob3I+

PFllYXI+MTk5NjwvWWVhcj48UmVjTnVtPjczPC9SZWNOdW0+PHJlY29yZD48cmVjLW51bWJlcj43

MzwvcmVjLW51bWJlcj48Zm9yZWlnbi1rZXlzPjxrZXkgYXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZl

NnZhOXo1ZWV2Mmw1NWFhOHN4c2E1OTllZXYycyI+NzM8L2tleT48L2ZvcmVpZ24ta2V5cz48cmVm

LXR5cGUgbmFtZT0iSm91cm5hbCBBcnRpY2xlIj4xNzwvcmVmLXR5cGU+PGNvbnRyaWJ1dG9ycz48

YXV0aG9ycz48YXV0aG9yPkhvbGxpZGF5LCBSLjwvYXV0aG9yPjxhdXRob3I+TWNGYXJsYW5kLCBH

LiBBLjwvYXV0aG9yPjwvYXV0aG9ycz48L2NvbnRyaWJ1dG9ycz48YXV0aC1hZGRyZXNzPkNTSVJP

IERpdmlzaW9uIG9mIEJpb21vbGVjdWxhciBFbmdpbmVlcmluZywgU3lkbmV5IExhYm9yYXRvcnks

IE5TVywgQXVzdHJhbGlhLjwvYXV0aC1hZGRyZXNzPjx0aXRsZXM+PHRpdGxlPkluaGliaXRpb24g

b2YgdGhlIGdyb3d0aCBvZiB0cmFuc2Zvcm1lZCBhbmQgbmVvcGxhc3RpYyBjZWxscyBieSB0aGUg

ZGlwZXB0aWRlIGNhcm5vc2luZTwvdGl0bGU+PHNlY29uZGFyeS10aXRsZT5CciBKIENhbmNlcjwv

c2Vjb25kYXJ5LXRpdGxlPjxhbHQtdGl0bGU+QnJpdGlzaCBqb3VybmFsIG9mIGNhbmNlcjwvYWx0

LXRpdGxlPjwvdGl0bGVzPjxwZXJpb2RpY2FsPjxmdWxsLXRpdGxlPkJyIEogQ2FuY2VyPC9mdWxs

LXRpdGxlPjxhYmJyLTE+QnJpdGlzaCBqb3VybmFsIG9mIGNhbmNlcjwvYWJici0xPjwvcGVyaW9k

aWNhbD48YWx0LXBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+QnIgSiBDYW5jZXI8L2Z1bGwtdGl0bGU+

PGFiYnItMT5Ccml0aXNoIGpvdXJuYWwgb2YgY2FuY2VyPC9hYmJyLTE+PC9hbHQtcGVyaW9kaWNh

bD48cGFnZXM+OTY2LTcxPC9wYWdlcz48dm9sdW1lPjczPC92b2x1bWU+PG51bWJlcj44PC9udW1i

ZXI+PGVkaXRpb24+MTk5Ni8wNC8wMTwvZWRpdGlvbj48a2V5d29yZHM+PGtleXdvcmQ+QW5pbWFs

czwva2V5d29yZD48a2V5d29yZD5BbnRpbmVvcGxhc3RpYyBBZ2VudHMvIHBoYXJtYWNvbG9neTwv

a2V5d29yZD48a2V5d29yZD5DYXJub3NpbmUvIHBoYXJtYWNvbG9neTwva2V5d29yZD48a2V5d29y

ZD5DZWxsIExpbmUsIFRyYW5zZm9ybWVkPC9rZXl3b3JkPjxrZXl3b3JkPkN1bHR1cmUgTWVkaWE8

L2tleXdvcmQ+PGtleXdvcmQ+R2x5Y29seXNpcy9kcnVnIGVmZmVjdHM8L2tleXdvcmQ+PGtleXdv

cmQ+SGVMYSBDZWxsczwva2V5d29yZD48a2V5d29yZD5IdW1hbnM8L2tleXdvcmQ+PGtleXdvcmQ+

UHlydXZhdGVzL21ldGFib2xpc208L2tleXdvcmQ+PGtleXdvcmQ+UHlydXZpYyBBY2lkPC9rZXl3

b3JkPjxrZXl3b3JkPlNpbWlhbiB2aXJ1cyA0MDwva2V5d29yZD48a2V5d29yZD5UdW1vciBDZWxs

cywgQ3VsdHVyZWQ8L2tleXdvcmQ+PC9rZXl3b3Jkcz48ZGF0ZXM+PHllYXI+MTk5NjwveWVhcj48

cHViLWRhdGVzPjxkYXRlPkFwcjwvZGF0ZT48L3B1Yi1kYXRlcz48L2RhdGVzPjxpc2JuPjAwMDct

MDkyMCAoUHJpbnQpJiN4RDswMDA3LTA5MjAgKExpbmtpbmcpPC9pc2JuPjxhY2Nlc3Npb24tbnVt

Pjg2MTE0MzM8L2FjY2Vzc2lvbi1udW0+PHVybHM+PC91cmxzPjxjdXN0b20yPlBNQzIwNzU4MTE8

L2N1c3RvbTI+PHJlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj5OTE08L3JlbW90ZS1kYXRhYmFzZS1w

cm92aWRlcj48bGFuZ3VhZ2U+ZW5nPC9sYW5ndWFnZT48L3JlY29yZD48L0NpdGU+PENpdGU+PEF1

dGhvcj5SZW5uZXI8L0F1dGhvcj48WWVhcj4yMDA4PC9ZZWFyPjxSZWNOdW0+OTE8L1JlY051bT48

cmVjb3JkPjxyZWMtbnVtYmVyPjkxPC9yZWMtbnVtYmVyPjxmb3JlaWduLWtleXM+PGtleSBhcHA9

IkVOIiBkYi1pZD0idzJ3ZnhhZmU2dmE5ejVlZXYybDU1YWE4c3hzYTU5OWVldjJzIj45MTwva2V5

PjwvZm9yZWlnbi1rZXlzPjxyZWYtdHlwZSBuYW1lPSJKb3VybmFsIEFydGljbGUiPjE3PC9yZWYt

dHlwZT48Y29udHJpYnV0b3JzPjxhdXRob3JzPjxhdXRob3I+UmVubmVyLCBDLiwgU2V5ZmZhcnRo

LCBBLiwgR2FyY2lhIGRlIEFycmliYSwgUy4sIE1laXhlbnNiZXJnZXIsIEouLCBHZWJoYXJkdCwg

Ui4sIEdhdW5pdHosIEYuPC9hdXRob3I+PC9hdXRob3JzPjwvY29udHJpYnV0b3JzPjx0aXRsZXM+

PHRpdGxlPkNhcm5vc2luZSBJbmhpYml0cyBHcm93dGggb2YgQ2VsbHMgSXNvbGF0ZWQgZnJvbSBI

dW1hbiBHbGlvYmxhc3RvbWEgTXVsdGlmb3JtZTwvdGl0bGU+PHNlY29uZGFyeS10aXRsZT5JbnRl

cm5hdGlvbmFsIEpvdXJuYWwgb2YgUGVwdGlkZSBSZXNlYXJjaCBhbmQgVGhlcmFwZXV0aWNzIDwv

c2Vjb25kYXJ5LXRpdGxlPjwvdGl0bGVzPjxwZXJpb2RpY2FsPjxmdWxsLXRpdGxlPkludGVybmF0

aW9uYWwgSm91cm5hbCBvZiBQZXB0aWRlIFJlc2VhcmNoIGFuZCBUaGVyYXBldXRpY3M8L2Z1bGwt

dGl0bGU+PC9wZXJpb2RpY2FsPjxwYWdlcz4xMjctMTM1PC9wYWdlcz48dm9sdW1lPjE0PC92b2x1

bWU+PHNlY3Rpb24+MTI3PC9zZWN0aW9uPjxkYXRlcz48eWVhcj4yMDA4PC95ZWFyPjwvZGF0ZXM+

PHVybHM+PC91cmxzPjwvcmVjb3JkPjwvQ2l0ZT48Q2l0ZT48QXV0aG9yPlJlbm5lcjwvQXV0aG9y

PjxZZWFyPjIwMTA8L1llYXI+PFJlY051bT43MDwvUmVjTnVtPjxyZWNvcmQ+PHJlYy1udW1iZXI+

NzA8L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5IGFwcD0iRU4iIGRiLWlkPSJ3MndmeGFm

ZTZ2YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjcwPC9rZXk+PC9mb3JlaWduLWtleXM+PHJl

Zi10eXBlIG5hbWU9IkpvdXJuYWwgQXJ0aWNsZSI+MTc8L3JlZi10eXBlPjxjb250cmlidXRvcnM+

PGF1dGhvcnM+PGF1dGhvcj5SZW5uZXIsIEMuPC9hdXRob3I+PGF1dGhvcj5aZW1pdHpzY2gsIE4u

PC9hdXRob3I+PGF1dGhvcj5GdWNocywgQi48L2F1dGhvcj48YXV0aG9yPkdlaWdlciwgSy4gRC48

L2F1dGhvcj48YXV0aG9yPkhlcm1lcywgTS48L2F1dGhvcj48YXV0aG9yPkhlbmdzdGxlciwgSi48

L2F1dGhvcj48YXV0aG9yPkdlYmhhcmR0LCBSLjwvYXV0aG9yPjxhdXRob3I+TWVpeGVuc2Jlcmdl

ciwgSi48L2F1dGhvcj48YXV0aG9yPkdhdW5pdHosIEYuPC9hdXRob3I+PC9hdXRob3JzPjwvY29u

dHJpYnV0b3JzPjxhdXRoLWFkZHJlc3M+S2xpbmlrIHVuZCBQb2xpa2xpbmlrIGZ1ciBOZXVyb2No

aXJ1cmdpZSwgVW5pdmVyc2l0YXRza2xpbmlrdW0gTGVpcHppZyB1bmQgTWVkaXppbmlzY2hlIEZh

a3VsdGF0IGRlciBVbml2ZXJzaXRhdCBMZWlwemlnLCBMZWlwemlnLCBHZXJtYW55LjwvYXV0aC1h

ZGRyZXNzPjx0aXRsZXM+PHRpdGxlPkNhcm5vc2luZSByZXRhcmRzIHR1bW9yIGdyb3d0aCBpbiB2

aXZvIGluIGFuIE5JSDNUMy1IRVIyL25ldSBtb3VzZSBtb2RlbDwvdGl0bGU+PHNlY29uZGFyeS10

aXRsZT5Nb2wgQ2FuY2VyPC9zZWNvbmRhcnktdGl0bGU+PGFsdC10aXRsZT5Nb2xlY3VsYXIgY2Fu

Y2VyPC9hbHQtdGl0bGU+PC90aXRsZXM+PHBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+TW9sIENhbmNl

cjwvZnVsbC10aXRsZT48YWJici0xPk1vbGVjdWxhciBjYW5jZXI8L2FiYnItMT48L3BlcmlvZGlj

YWw+PGFsdC1wZXJpb2RpY2FsPjxmdWxsLXRpdGxlPk1vbCBDYW5jZXI8L2Z1bGwtdGl0bGU+PGFi

YnItMT5Nb2xlY3VsYXIgY2FuY2VyPC9hYmJyLTE+PC9hbHQtcGVyaW9kaWNhbD48cGFnZXM+Mjwv

cGFnZXM+PHZvbHVtZT45PC92b2x1bWU+PGVkaXRpb24+MjAxMC8wMS8wODwvZWRpdGlvbj48a2V5

d29yZHM+PGtleXdvcmQ+QWRlbm9zaW5lIFRyaXBob3NwaGF0ZS9tZXRhYm9saXNtPC9rZXl3b3Jk

PjxrZXl3b3JkPkFuaW1hbHM8L2tleXdvcmQ+PGtleXdvcmQ+Q2Fybm9zaW5lL2FkbWluaXN0cmF0

aW9uICZhbXA7IGRvc2FnZS9ibG9vZC8gcGhhcm1hY29sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPkNl

bGwgUHJvbGlmZXJhdGlvbi9kcnVnIGVmZmVjdHM8L2tleXdvcmQ+PGtleXdvcmQ+RGlzZWFzZSBN

b2RlbHMsIEFuaW1hbDwva2V5d29yZD48a2V5d29yZD5EcnVnIFNjcmVlbmluZyBBc3NheXMsIEFu

dGl0dW1vcjwva2V5d29yZD48a2V5d29yZD5GZW1hbGU8L2tleXdvcmQ+PGtleXdvcmQ+SW5qZWN0

aW9ucywgSW50cmFwZXJpdG9uZWFsPC9rZXl3b3JkPjxrZXl3b3JkPk1pY2U8L2tleXdvcmQ+PGtl

eXdvcmQ+TWljZSwgTnVkZTwva2V5d29yZD48a2V5d29yZD5NaXRvc2lzL2RydWcgZWZmZWN0czwv

a2V5d29yZD48a2V5d29yZD5OSUggM1QzIENlbGxzPC9rZXl3b3JkPjxrZXl3b3JkPk5lb3BsYXNt

cy8gcGF0aG9sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPk94aWRvcmVkdWN0YXNlcy9tZXRhYm9saXNt

PC9rZXl3b3JkPjxrZXl3b3JkPlJlY2VwdG9yLCBlcmJCLTIvIG1ldGFib2xpc208L2tleXdvcmQ+

PC9rZXl3b3Jkcz48ZGF0ZXM+PHllYXI+MjAxMDwveWVhcj48L2RhdGVzPjxpc2JuPjE0NzYtNDU5

OCAoRWxlY3Ryb25pYykmI3hEOzE0NzYtNDU5OCAoTGlua2luZyk8L2lzYm4+PGFjY2Vzc2lvbi1u

dW0+MjAwNTMyODM8L2FjY2Vzc2lvbi1udW0+PHVybHM+PC91cmxzPjxjdXN0b20yPlBNQzI4MTg2

OTQ8L2N1c3RvbTI+PGVsZWN0cm9uaWMtcmVzb3VyY2UtbnVtPjEwLjExODYvMTQ3Ni00NTk4LTkt

MjwvZWxlY3Ryb25pYy1yZXNvdXJjZS1udW0+PHJlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj5OTE08

L3JlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj48bGFuZ3VhZ2U+ZW5nPC9sYW5ndWFnZT48L3JlY29y

ZD48L0NpdGU+PC9FbmROb3RlPgB=

ADDIN EN.CITE PEVuZE5vdGU+PENpdGU+PEF1dGhvcj5OYWdhaTwvQXV0aG9yPjxZZWFyPjE5ODY8L1llYXI+PFJl

Y051bT44ODwvUmVjTnVtPjxEaXNwbGF5VGV4dD5bMjAsIDIxLCAyMywgMjA4XTwvRGlzcGxheVRl

eHQ+PHJlY29yZD48cmVjLW51bWJlcj44ODwvcmVjLW51bWJlcj48Zm9yZWlnbi1rZXlzPjxrZXkg

YXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZlNnZhOXo1ZWV2Mmw1NWFhOHN4c2E1OTllZXYycyI+ODg8

L2tleT48L2ZvcmVpZ24ta2V5cz48cmVmLXR5cGUgbmFtZT0iSm91cm5hbCBBcnRpY2xlIj4xNzwv

cmVmLXR5cGU+PGNvbnRyaWJ1dG9ycz48YXV0aG9ycz48YXV0aG9yPk5hZ2FpLCBLLjwvYXV0aG9y

PjxhdXRob3I+U3VkYSwgVC48L2F1dGhvcj48L2F1dGhvcnM+PC9jb250cmlidXRvcnM+PHRpdGxl

cz48dGl0bGU+W0FudGluZW9wbGFzdGljIGVmZmVjdHMgb2YgY2Fybm9zaW5lIGFuZCBiZXRhLWFs

YW5pbmUtLXBoeXNpb2xvZ2ljYWwgY29uc2lkZXJhdGlvbnMgb2YgaXRzIGFudGluZW9wbGFzdGlj

IGVmZmVjdHNdPC90aXRsZT48c2Vjb25kYXJ5LXRpdGxlPk5paG9uIFNlaXJpZ2FrdSBaYXNzaGk8

L3NlY29uZGFyeS10aXRsZT48YWx0LXRpdGxlPk5paG9uIHNlaXJpZ2FrdSB6YXNzaGkuIEpvdXJu

YWwgb2YgdGhlIFBoeXNpb2xvZ2ljYWwgU29jaWV0eSBvZiBKYXBhbjwvYWx0LXRpdGxlPjwvdGl0

bGVzPjxwZXJpb2RpY2FsPjxmdWxsLXRpdGxlPk5paG9uIFNlaXJpZ2FrdSBaYXNzaGk8L2Z1bGwt

dGl0bGU+PGFiYnItMT5OaWhvbiBzZWlyaWdha3UgemFzc2hpLiBKb3VybmFsIG9mIHRoZSBQaHlz

aW9sb2dpY2FsIFNvY2lldHkgb2YgSmFwYW48L2FiYnItMT48L3BlcmlvZGljYWw+PGFsdC1wZXJp

b2RpY2FsPjxmdWxsLXRpdGxlPk5paG9uIFNlaXJpZ2FrdSBaYXNzaGk8L2Z1bGwtdGl0bGU+PGFi

YnItMT5OaWhvbiBzZWlyaWdha3UgemFzc2hpLiBKb3VybmFsIG9mIHRoZSBQaHlzaW9sb2dpY2Fs

IFNvY2lldHkgb2YgSmFwYW48L2FiYnItMT48L2FsdC1wZXJpb2RpY2FsPjxwYWdlcz43NDEtNzwv

cGFnZXM+PHZvbHVtZT40ODwvdm9sdW1lPjxudW1iZXI+MTE8L251bWJlcj48ZWRpdGlvbj4xOTg2

LzAxLzAxPC9lZGl0aW9uPjxrZXl3b3Jkcz48a2V5d29yZD5BbGFuaW5lLyBwaGFybWFjb2xvZ3k8

L2tleXdvcmQ+PGtleXdvcmQ+QW5pbWFsczwva2V5d29yZD48a2V5d29yZD5BbnRpbmVvcGxhc3Rp

YyBBZ2VudHM8L2tleXdvcmQ+PGtleXdvcmQ+Q2Fybm9zaW5lL2FkbWluaXN0cmF0aW9uICZhbXA7

IGRvc2FnZS8gcGhhcm1hY29sb2d5L3RoZXJhcGV1dGljIHVzZTwva2V5d29yZD48a2V5d29yZD5E

aXBlcHRpZGVzLyBwaGFybWFjb2xvZ3k8L2tleXdvcmQ+PGtleXdvcmQ+TWFsZTwva2V5d29yZD48

a2V5d29yZD5NaWNlPC9rZXl3b3JkPjxrZXl3b3JkPk1pdG9teWNpbjwva2V5d29yZD48a2V5d29y

ZD5NaXRvbXljaW5zL2FkbWluaXN0cmF0aW9uICZhbXA7IGRvc2FnZTwva2V5d29yZD48a2V5d29y

ZD5QaWNpYmFuaWwvYWRtaW5pc3RyYXRpb24gJmFtcDsgZG9zYWdlPC9rZXl3b3JkPjxrZXl3b3Jk

PlNhcmNvbWEgMTgwL2RydWcgdGhlcmFweTwva2V5d29yZD48a2V5d29yZD5iZXRhLUFsYW5pbmUv

YWRtaW5pc3RyYXRpb24gJmFtcDsgZG9zYWdlLyBwaGFybWFjb2xvZ3kvdGhlcmFwZXV0aWMgdXNl

PC9rZXl3b3JkPjwva2V5d29yZHM+PGRhdGVzPjx5ZWFyPjE5ODY8L3llYXI+PC9kYXRlcz48aXNi

bj4wMDMxLTkzNDEgKFByaW50KSYjeEQ7MDAzMS05MzQxIChMaW5raW5nKTwvaXNibj48YWNjZXNz

aW9uLW51bT4zMTAyNzIxPC9hY2Nlc3Npb24tbnVtPjx1cmxzPjwvdXJscz48cmVtb3RlLWRhdGFi

YXNlLXByb3ZpZGVyPk5MTTwvcmVtb3RlLWRhdGFiYXNlLXByb3ZpZGVyPjxsYW5ndWFnZT5qcG48

L2xhbmd1YWdlPjwvcmVjb3JkPjwvQ2l0ZT48Q2l0ZT48QXV0aG9yPkhvbGxpZGF5PC9BdXRob3I+

PFllYXI+MTk5NjwvWWVhcj48UmVjTnVtPjczPC9SZWNOdW0+PHJlY29yZD48cmVjLW51bWJlcj43

MzwvcmVjLW51bWJlcj48Zm9yZWlnbi1rZXlzPjxrZXkgYXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZl

NnZhOXo1ZWV2Mmw1NWFhOHN4c2E1OTllZXYycyI+NzM8L2tleT48L2ZvcmVpZ24ta2V5cz48cmVm

LXR5cGUgbmFtZT0iSm91cm5hbCBBcnRpY2xlIj4xNzwvcmVmLXR5cGU+PGNvbnRyaWJ1dG9ycz48

YXV0aG9ycz48YXV0aG9yPkhvbGxpZGF5LCBSLjwvYXV0aG9yPjxhdXRob3I+TWNGYXJsYW5kLCBH

LiBBLjwvYXV0aG9yPjwvYXV0aG9ycz48L2NvbnRyaWJ1dG9ycz48YXV0aC1hZGRyZXNzPkNTSVJP

IERpdmlzaW9uIG9mIEJpb21vbGVjdWxhciBFbmdpbmVlcmluZywgU3lkbmV5IExhYm9yYXRvcnks

IE5TVywgQXVzdHJhbGlhLjwvYXV0aC1hZGRyZXNzPjx0aXRsZXM+PHRpdGxlPkluaGliaXRpb24g

b2YgdGhlIGdyb3d0aCBvZiB0cmFuc2Zvcm1lZCBhbmQgbmVvcGxhc3RpYyBjZWxscyBieSB0aGUg

ZGlwZXB0aWRlIGNhcm5vc2luZTwvdGl0bGU+PHNlY29uZGFyeS10aXRsZT5CciBKIENhbmNlcjwv

c2Vjb25kYXJ5LXRpdGxlPjxhbHQtdGl0bGU+QnJpdGlzaCBqb3VybmFsIG9mIGNhbmNlcjwvYWx0

LXRpdGxlPjwvdGl0bGVzPjxwZXJpb2RpY2FsPjxmdWxsLXRpdGxlPkJyIEogQ2FuY2VyPC9mdWxs

LXRpdGxlPjxhYmJyLTE+QnJpdGlzaCBqb3VybmFsIG9mIGNhbmNlcjwvYWJici0xPjwvcGVyaW9k

aWNhbD48YWx0LXBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+QnIgSiBDYW5jZXI8L2Z1bGwtdGl0bGU+

PGFiYnItMT5Ccml0aXNoIGpvdXJuYWwgb2YgY2FuY2VyPC9hYmJyLTE+PC9hbHQtcGVyaW9kaWNh

bD48cGFnZXM+OTY2LTcxPC9wYWdlcz48dm9sdW1lPjczPC92b2x1bWU+PG51bWJlcj44PC9udW1i

ZXI+PGVkaXRpb24+MTk5Ni8wNC8wMTwvZWRpdGlvbj48a2V5d29yZHM+PGtleXdvcmQ+QW5pbWFs

czwva2V5d29yZD48a2V5d29yZD5BbnRpbmVvcGxhc3RpYyBBZ2VudHMvIHBoYXJtYWNvbG9neTwv

a2V5d29yZD48a2V5d29yZD5DYXJub3NpbmUvIHBoYXJtYWNvbG9neTwva2V5d29yZD48a2V5d29y

ZD5DZWxsIExpbmUsIFRyYW5zZm9ybWVkPC9rZXl3b3JkPjxrZXl3b3JkPkN1bHR1cmUgTWVkaWE8

L2tleXdvcmQ+PGtleXdvcmQ+R2x5Y29seXNpcy9kcnVnIGVmZmVjdHM8L2tleXdvcmQ+PGtleXdv

cmQ+SGVMYSBDZWxsczwva2V5d29yZD48a2V5d29yZD5IdW1hbnM8L2tleXdvcmQ+PGtleXdvcmQ+

UHlydXZhdGVzL21ldGFib2xpc208L2tleXdvcmQ+PGtleXdvcmQ+UHlydXZpYyBBY2lkPC9rZXl3

b3JkPjxrZXl3b3JkPlNpbWlhbiB2aXJ1cyA0MDwva2V5d29yZD48a2V5d29yZD5UdW1vciBDZWxs

cywgQ3VsdHVyZWQ8L2tleXdvcmQ+PC9rZXl3b3Jkcz48ZGF0ZXM+PHllYXI+MTk5NjwveWVhcj48

cHViLWRhdGVzPjxkYXRlPkFwcjwvZGF0ZT48L3B1Yi1kYXRlcz48L2RhdGVzPjxpc2JuPjAwMDct

MDkyMCAoUHJpbnQpJiN4RDswMDA3LTA5MjAgKExpbmtpbmcpPC9pc2JuPjxhY2Nlc3Npb24tbnVt

Pjg2MTE0MzM8L2FjY2Vzc2lvbi1udW0+PHVybHM+PC91cmxzPjxjdXN0b20yPlBNQzIwNzU4MTE8

L2N1c3RvbTI+PHJlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj5OTE08L3JlbW90ZS1kYXRhYmFzZS1w

cm92aWRlcj48bGFuZ3VhZ2U+ZW5nPC9sYW5ndWFnZT48L3JlY29yZD48L0NpdGU+PENpdGU+PEF1

dGhvcj5SZW5uZXI8L0F1dGhvcj48WWVhcj4yMDA4PC9ZZWFyPjxSZWNOdW0+OTE8L1JlY051bT48

cmVjb3JkPjxyZWMtbnVtYmVyPjkxPC9yZWMtbnVtYmVyPjxmb3JlaWduLWtleXM+PGtleSBhcHA9

IkVOIiBkYi1pZD0idzJ3ZnhhZmU2dmE5ejVlZXYybDU1YWE4c3hzYTU5OWVldjJzIj45MTwva2V5

PjwvZm9yZWlnbi1rZXlzPjxyZWYtdHlwZSBuYW1lPSJKb3VybmFsIEFydGljbGUiPjE3PC9yZWYt

dHlwZT48Y29udHJpYnV0b3JzPjxhdXRob3JzPjxhdXRob3I+UmVubmVyLCBDLiwgU2V5ZmZhcnRo

LCBBLiwgR2FyY2lhIGRlIEFycmliYSwgUy4sIE1laXhlbnNiZXJnZXIsIEouLCBHZWJoYXJkdCwg

Ui4sIEdhdW5pdHosIEYuPC9hdXRob3I+PC9hdXRob3JzPjwvY29udHJpYnV0b3JzPjx0aXRsZXM+

PHRpdGxlPkNhcm5vc2luZSBJbmhpYml0cyBHcm93dGggb2YgQ2VsbHMgSXNvbGF0ZWQgZnJvbSBI

dW1hbiBHbGlvYmxhc3RvbWEgTXVsdGlmb3JtZTwvdGl0bGU+PHNlY29uZGFyeS10aXRsZT5JbnRl

cm5hdGlvbmFsIEpvdXJuYWwgb2YgUGVwdGlkZSBSZXNlYXJjaCBhbmQgVGhlcmFwZXV0aWNzIDwv

c2Vjb25kYXJ5LXRpdGxlPjwvdGl0bGVzPjxwZXJpb2RpY2FsPjxmdWxsLXRpdGxlPkludGVybmF0

aW9uYWwgSm91cm5hbCBvZiBQZXB0aWRlIFJlc2VhcmNoIGFuZCBUaGVyYXBldXRpY3M8L2Z1bGwt

dGl0bGU+PC9wZXJpb2RpY2FsPjxwYWdlcz4xMjctMTM1PC9wYWdlcz48dm9sdW1lPjE0PC92b2x1

bWU+PHNlY3Rpb24+MTI3PC9zZWN0aW9uPjxkYXRlcz48eWVhcj4yMDA4PC95ZWFyPjwvZGF0ZXM+

PHVybHM+PC91cmxzPjwvcmVjb3JkPjwvQ2l0ZT48Q2l0ZT48QXV0aG9yPlJlbm5lcjwvQXV0aG9y

PjxZZWFyPjIwMTA8L1llYXI+PFJlY051bT43MDwvUmVjTnVtPjxyZWNvcmQ+PHJlYy1udW1iZXI+

NzA8L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5IGFwcD0iRU4iIGRiLWlkPSJ3MndmeGFm

ZTZ2YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjcwPC9rZXk+PC9mb3JlaWduLWtleXM+PHJl

Zi10eXBlIG5hbWU9IkpvdXJuYWwgQXJ0aWNsZSI+MTc8L3JlZi10eXBlPjxjb250cmlidXRvcnM+

PGF1dGhvcnM+PGF1dGhvcj5SZW5uZXIsIEMuPC9hdXRob3I+PGF1dGhvcj5aZW1pdHpzY2gsIE4u

PC9hdXRob3I+PGF1dGhvcj5GdWNocywgQi48L2F1dGhvcj48YXV0aG9yPkdlaWdlciwgSy4gRC48

L2F1dGhvcj48YXV0aG9yPkhlcm1lcywgTS48L2F1dGhvcj48YXV0aG9yPkhlbmdzdGxlciwgSi48

L2F1dGhvcj48YXV0aG9yPkdlYmhhcmR0LCBSLjwvYXV0aG9yPjxhdXRob3I+TWVpeGVuc2Jlcmdl

ciwgSi48L2F1dGhvcj48YXV0aG9yPkdhdW5pdHosIEYuPC9hdXRob3I+PC9hdXRob3JzPjwvY29u

dHJpYnV0b3JzPjxhdXRoLWFkZHJlc3M+S2xpbmlrIHVuZCBQb2xpa2xpbmlrIGZ1ciBOZXVyb2No

aXJ1cmdpZSwgVW5pdmVyc2l0YXRza2xpbmlrdW0gTGVpcHppZyB1bmQgTWVkaXppbmlzY2hlIEZh

a3VsdGF0IGRlciBVbml2ZXJzaXRhdCBMZWlwemlnLCBMZWlwemlnLCBHZXJtYW55LjwvYXV0aC1h

ZGRyZXNzPjx0aXRsZXM+PHRpdGxlPkNhcm5vc2luZSByZXRhcmRzIHR1bW9yIGdyb3d0aCBpbiB2

aXZvIGluIGFuIE5JSDNUMy1IRVIyL25ldSBtb3VzZSBtb2RlbDwvdGl0bGU+PHNlY29uZGFyeS10

aXRsZT5Nb2wgQ2FuY2VyPC9zZWNvbmRhcnktdGl0bGU+PGFsdC10aXRsZT5Nb2xlY3VsYXIgY2Fu

Y2VyPC9hbHQtdGl0bGU+PC90aXRsZXM+PHBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+TW9sIENhbmNl

cjwvZnVsbC10aXRsZT48YWJici0xPk1vbGVjdWxhciBjYW5jZXI8L2FiYnItMT48L3BlcmlvZGlj

YWw+PGFsdC1wZXJpb2RpY2FsPjxmdWxsLXRpdGxlPk1vbCBDYW5jZXI8L2Z1bGwtdGl0bGU+PGFi

YnItMT5Nb2xlY3VsYXIgY2FuY2VyPC9hYmJyLTE+PC9hbHQtcGVyaW9kaWNhbD48cGFnZXM+Mjwv

cGFnZXM+PHZvbHVtZT45PC92b2x1bWU+PGVkaXRpb24+MjAxMC8wMS8wODwvZWRpdGlvbj48a2V5

d29yZHM+PGtleXdvcmQ+QWRlbm9zaW5lIFRyaXBob3NwaGF0ZS9tZXRhYm9saXNtPC9rZXl3b3Jk

PjxrZXl3b3JkPkFuaW1hbHM8L2tleXdvcmQ+PGtleXdvcmQ+Q2Fybm9zaW5lL2FkbWluaXN0cmF0

aW9uICZhbXA7IGRvc2FnZS9ibG9vZC8gcGhhcm1hY29sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPkNl

bGwgUHJvbGlmZXJhdGlvbi9kcnVnIGVmZmVjdHM8L2tleXdvcmQ+PGtleXdvcmQ+RGlzZWFzZSBN

b2RlbHMsIEFuaW1hbDwva2V5d29yZD48a2V5d29yZD5EcnVnIFNjcmVlbmluZyBBc3NheXMsIEFu

dGl0dW1vcjwva2V5d29yZD48a2V5d29yZD5GZW1hbGU8L2tleXdvcmQ+PGtleXdvcmQ+SW5qZWN0

aW9ucywgSW50cmFwZXJpdG9uZWFsPC9rZXl3b3JkPjxrZXl3b3JkPk1pY2U8L2tleXdvcmQ+PGtl

eXdvcmQ+TWljZSwgTnVkZTwva2V5d29yZD48a2V5d29yZD5NaXRvc2lzL2RydWcgZWZmZWN0czwv

a2V5d29yZD48a2V5d29yZD5OSUggM1QzIENlbGxzPC9rZXl3b3JkPjxrZXl3b3JkPk5lb3BsYXNt

cy8gcGF0aG9sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPk94aWRvcmVkdWN0YXNlcy9tZXRhYm9saXNt

PC9rZXl3b3JkPjxrZXl3b3JkPlJlY2VwdG9yLCBlcmJCLTIvIG1ldGFib2xpc208L2tleXdvcmQ+

PC9rZXl3b3Jkcz48ZGF0ZXM+PHllYXI+MjAxMDwveWVhcj48L2RhdGVzPjxpc2JuPjE0NzYtNDU5

OCAoRWxlY3Ryb25pYykmI3hEOzE0NzYtNDU5OCAoTGlua2luZyk8L2lzYm4+PGFjY2Vzc2lvbi1u

dW0+MjAwNTMyODM8L2FjY2Vzc2lvbi1udW0+PHVybHM+PC91cmxzPjxjdXN0b20yPlBNQzI4MTg2

OTQ8L2N1c3RvbTI+PGVsZWN0cm9uaWMtcmVzb3VyY2UtbnVtPjEwLjExODYvMTQ3Ni00NTk4LTkt

MjwvZWxlY3Ryb25pYy1yZXNvdXJjZS1udW0+PHJlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj5OTE08

L3JlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj48bGFuZ3VhZ2U+ZW5nPC9sYW5ndWFnZT48L3JlY29y

ZD48L0NpdGU+PC9FbmROb3RlPgB=

ADDIN EN.CITE.DATA [20, 21, 23, 208], однако механизм регуляции клеточной пролиферации с помощью карнозина до сих пор остается до конца не исследованным.

3.1.1. Карнозин снижает количество клеток РС-12 в культуреДля изучения влияния карнозина на пролиферацию опухолевых клеток, была выбрана культура клеток феохромоцитомы крысы РС-12. Клетки обрабатывали карнозином (10 - 50 мМ) в течение 48 ч и затем считали количество клеток в каждой пробе с помощью камеры Горяева.

Рисунок 3.1.

1. Карнозин снижает количество клеток РС-12 в культуре. Клетки обрабатывали карнозином (10 - 50 мМ) в течение 48 ч. (А) Общее количество клеток подсчитывали в камере Горяева. Звездочка обозначает статистически значимое отличие от количества клеток в контроле; n=3, p<0.05. (В) Процент погибших клеток определяли с помощью проточного цитометра по количеству клеток меченных PI. Звездочка обозначает статистически значимое отличие от количества некротических клеток в контроле; n=3, p<0.05.

На Рис. 3.1.1.А. представлены результаты подсчета количества клеток в контроле и пробах обработанных карнозином. Как следует из Рис. 3.1.1.А, инкубация с карнозином приводила к дозо-зависимому снижению количества клеток РС-12. Количество клеток в пробах обработанных 10 мМ карнозина составляло 69% от контроля, 25 мМ – 52%, 50 мМ – 45%. Уменьшение количества клеток происходит в результате их гибели или при замедлении пролиферации. Для того чтобы выяснить, усиливает ли карнозин гибель клеток РС-12 клетки обрабатывали карнозином (10 – 50 мМ) в течение 48 ч, окрашивали маркером погибших клеток, PI, и анализировали интенсивность флуоресценции PI на проточном цитометре. Из Рис. 3.1.1.Б. видно, что достоверных различий в количестве погибших клеток в контроле и пробах, обработанных карнозином, обнаружено не было (Рис. I.1.Б). Исходя из полученных данных, был сделан вывод о том, что снижение общего количества клеток РС-12 под действием карнозина не связано с гибелью клеток и, предположительно, является результатом замедления пролиферации.

3.1.2. Карнозин снижает уровень АФК в клетках культуры РС-121778028575Рисунок 3.1.2. Карнозин снижает уровень АФК в клетках РС-12. Клетки инкубировали с 50 мМ карнозина в течение 0,5 - 48 ч. Уровень АФК измеряли на проточном цитометре по степени окисления DCFH2-DA. Звездочка обозначает статистически значимое отличие от уровня АФК в контроле; n=3, p<0.05.

Быстро пролиферирующие клетки часто характеризуются повышенным содержанием АФК. Понижение уровня АФК в этих клетках с помощью антиоксидантов приводит к снижению скорости пролиферации PEVuZE5vdGU+PENpdGU+PEF1dGhvcj5Hb3N3YW1pPC9BdXRob3I+PFllYXI+MjAwMDwvWWVhcj48

UmVjTnVtPjkyPC9SZWNOdW0+PERpc3BsYXlUZXh0PlsyNiwgNjYsIDE0OV08L0Rpc3BsYXlUZXh0

PjxyZWNvcmQ+PHJlYy1udW1iZXI+OTI8L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5IGFw

cD0iRU4iIGRiLWlkPSJ3MndmeGFmZTZ2YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjkyPC9r

ZXk+PC9mb3JlaWduLWtleXM+PHJlZi10eXBlIG5hbWU9IkpvdXJuYWwgQXJ0aWNsZSI+MTc8L3Jl

Zi10eXBlPjxjb250cmlidXRvcnM+PGF1dGhvcnM+PGF1dGhvcj5Hb3N3YW1pLCBQLiBDLjwvYXV0

aG9yPjxhdXRob3I+U2hlcmVuLCBKLjwvYXV0aG9yPjxhdXRob3I+QWxiZWUsIEwuIEQuPC9hdXRo

b3I+PGF1dGhvcj5QYXJzaWFuLCBBLjwvYXV0aG9yPjxhdXRob3I+U2ltLCBKLiBFLjwvYXV0aG9y

PjxhdXRob3I+Umlkbm91ciwgTC4gQS48L2F1dGhvcj48YXV0aG9yPkhpZ2FzaGlrdWJvLCBSLjwv

YXV0aG9yPjxhdXRob3I+R2l1cywgRC48L2F1dGhvcj48YXV0aG9yPkh1bnQsIEMuIFIuPC9hdXRo

b3I+PGF1dGhvcj5TcGl0eiwgRC4gUi48L2F1dGhvcj48L2F1dGhvcnM+PC9jb250cmlidXRvcnM+

PGF1dGgtYWRkcmVzcz5SYWRpYXRpb24gT25jb2xvZ3kgQ2VudGVyLCBNSVIsIFdhc2hpbmd0b24g

VW5pdmVyc2l0eSBNZWRpY2FsIFNjaG9vbCwgU3QuIExvdWlzLCBNaXNzb3VyaSA2MzEwOCwgVVNB

LjwvYXV0aC1hZGRyZXNzPjx0aXRsZXM+PHRpdGxlPkNlbGwgY3ljbGUtY291cGxlZCB2YXJpYXRp

b24gaW4gdG9wb2lzb21lcmFzZSBJSWFscGhhIG1STkEgaXMgcmVndWxhdGVkIGJ5IHRoZSAzJmFw

b3M7LXVudHJhbnNsYXRlZCByZWdpb24uIFBvc3NpYmxlIHJvbGUgb2YgcmVkb3gtc2Vuc2l0aXZl

IHByb3RlaW4gYmluZGluZyBpbiBtUk5BIGFjY3VtdWxhdGlvbjwvdGl0bGU+PHNlY29uZGFyeS10

aXRsZT5KIEJpb2wgQ2hlbTwvc2Vjb25kYXJ5LXRpdGxlPjxhbHQtdGl0bGU+VGhlIEpvdXJuYWwg

b2YgYmlvbG9naWNhbCBjaGVtaXN0cnk8L2FsdC10aXRsZT48L3RpdGxlcz48cGVyaW9kaWNhbD48

ZnVsbC10aXRsZT5KIEJpb2wgQ2hlbTwvZnVsbC10aXRsZT48YWJici0xPlRoZSBKb3VybmFsIG9m

IGJpb2xvZ2ljYWwgY2hlbWlzdHJ5PC9hYmJyLTE+PC9wZXJpb2RpY2FsPjxhbHQtcGVyaW9kaWNh

bD48ZnVsbC10aXRsZT5KIEJpb2wgQ2hlbTwvZnVsbC10aXRsZT48YWJici0xPlRoZSBKb3VybmFs

IG9mIGJpb2xvZ2ljYWwgY2hlbWlzdHJ5PC9hYmJyLTE+PC9hbHQtcGVyaW9kaWNhbD48cGFnZXM+

MzgzODQtOTI8L3BhZ2VzPjx2b2x1bWU+Mjc1PC92b2x1bWU+PG51bWJlcj40OTwvbnVtYmVyPjxl

ZGl0aW9uPjIwMDAvMDkvMTU8L2VkaXRpb24+PGtleXdvcmRzPjxrZXl3b3JkPjMmYXBvczsgVW50

cmFuc2xhdGVkIFJlZ2lvbnMvIGdlbmV0aWNzPC9rZXl3b3JkPjxrZXl3b3JkPjNUMyBDZWxsczwv

a2V5d29yZD48a2V5d29yZD5BbmltYWxzPC9rZXl3b3JkPjxrZXl3b3JkPkFudGlnZW5zLCBOZW9w

bGFzbTwva2V5d29yZD48a2V5d29yZD5CYXNlIFNlcXVlbmNlPC9rZXl3b3JkPjxrZXl3b3JkPkNl

bGwgQ3ljbGUvIHBoeXNpb2xvZ3k8L2tleXdvcmQ+PGtleXdvcmQ+RE5BIFRvcG9pc29tZXJhc2Vz

LCBUeXBlIElJLyBnZW5ldGljczwva2V5d29yZD48a2V5d29yZD5ETkEtQmluZGluZyBQcm90ZWlu

czwva2V5d29yZD48a2V5d29yZD5HZW5lIEV4cHJlc3Npb24gUmVndWxhdGlvbiwgRW56eW1vbG9n

aWM8L2tleXdvcmQ+PGtleXdvcmQ+R2VuZXMsIFJlcG9ydGVyPC9rZXl3b3JkPjxrZXl3b3JkPkdl

bmV0aWMgVmFyaWF0aW9uPC9rZXl3b3JkPjxrZXl3b3JkPkhlTGEgQ2VsbHM8L2tleXdvcmQ+PGtl

eXdvcmQ+SHVtYW5zPC9rZXl3b3JkPjxrZXl3b3JkPklzb2VuenltZXMvIGdlbmV0aWNzPC9rZXl3

b3JkPjxrZXl3b3JkPk1hbW1hbHM8L2tleXdvcmQ+PGtleXdvcmQ+TWljZTwva2V5d29yZD48a2V5

d29yZD5Nb2xlY3VsYXIgU2VxdWVuY2UgRGF0YTwva2V5d29yZD48a2V5d29yZD5STkEsIE1lc3Nl

bmdlci8gZ2VuZXRpY3M8L2tleXdvcmQ+PGtleXdvcmQ+Uk5BLUJpbmRpbmcgUHJvdGVpbnMvbWV0

YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5SZWNvbWJpbmFudCBQcm90ZWlucy9iaW9zeW50aGVz

aXM8L2tleXdvcmQ+PGtleXdvcmQ+VHJhbnNjcmlwdGlvbiwgR2VuZXRpYzwva2V5d29yZD48a2V5

d29yZD5UcmFuc2ZlY3Rpb248L2tleXdvcmQ+PGtleXdvcmQ+VWx0cmF2aW9sZXQgUmF5czwva2V5

d29yZD48L2tleXdvcmRzPjxkYXRlcz48eWVhcj4yMDAwPC95ZWFyPjxwdWItZGF0ZXM+PGRhdGU+

RGVjIDg8L2RhdGU+PC9wdWItZGF0ZXM+PC9kYXRlcz48aXNibj4wMDIxLTkyNTggKFByaW50KSYj

eEQ7MDAyMS05MjU4IChMaW5raW5nKTwvaXNibj48YWNjZXNzaW9uLW51bT4xMDk4NjI4MzwvYWNj

ZXNzaW9uLW51bT48dXJscz48L3VybHM+PGVsZWN0cm9uaWMtcmVzb3VyY2UtbnVtPjEwLjEwNzQv

amJjLk0wMDUyOTgyMDA8L2VsZWN0cm9uaWMtcmVzb3VyY2UtbnVtPjxyZW1vdGUtZGF0YWJhc2Ut

cHJvdmlkZXI+TkxNPC9yZW1vdGUtZGF0YWJhc2UtcHJvdmlkZXI+PGxhbmd1YWdlPmVuZzwvbGFu

Z3VhZ2U+PC9yZWNvcmQ+PC9DaXRlPjxDaXRlPjxBdXRob3I+Q29ub3VyPC9BdXRob3I+PFllYXI+

MjAwNDwvWWVhcj48UmVjTnVtPjM1PC9SZWNOdW0+PHJlY29yZD48cmVjLW51bWJlcj4zNTwvcmVj

LW51bWJlcj48Zm9yZWlnbi1rZXlzPjxrZXkgYXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZlNnZhOXo1

ZWV2Mmw1NWFhOHN4c2E1OTllZXYycyI+MzU8L2tleT48L2ZvcmVpZ24ta2V5cz48cmVmLXR5cGUg

bmFtZT0iSm91cm5hbCBBcnRpY2xlIj4xNzwvcmVmLXR5cGU+PGNvbnRyaWJ1dG9ycz48YXV0aG9y

cz48YXV0aG9yPkNvbm91ciwgSi4gRS48L2F1dGhvcj48YXV0aG9yPkdyYWhhbSwgVy4gVi48L2F1

dGhvcj48YXV0aG9yPkdhc2tpbnMsIEguIFIuPC9hdXRob3I+PC9hdXRob3JzPjwvY29udHJpYnV0

b3JzPjxhdXRoLWFkZHJlc3M+RGVwYXJ0bWVudCBvZiBBbmltYWwgU2NpZW5jZXMsIFVuaXZlcnNp

dHkgb2YgSWxsaW5vaXMsIFVyYmFuYSwgSWxsaW5vaXMgNjE4MDEsIFVTQS48L2F1dGgtYWRkcmVz

cz48dGl0bGVzPjx0aXRsZT5BIGNvbWJpbmVkIGluIHZpdHJvL2Jpb2luZm9ybWF0aWMgaW52ZXN0

aWdhdGlvbiBvZiByZWRveCByZWd1bGF0b3J5IG1lY2hhbmlzbXMgZ292ZXJuaW5nIGNlbGwgY3lj

bGUgcHJvZ3Jlc3Npb248L3RpdGxlPjxzZWNvbmRhcnktdGl0bGU+UGh5c2lvbCBHZW5vbWljczwv

c2Vjb25kYXJ5LXRpdGxlPjxhbHQtdGl0bGU+UGh5c2lvbG9naWNhbCBnZW5vbWljczwvYWx0LXRp

dGxlPjwvdGl0bGVzPjxwZXJpb2RpY2FsPjxmdWxsLXRpdGxlPlBoeXNpb2wgR2Vub21pY3M8L2Z1

bGwtdGl0bGU+PGFiYnItMT5QaHlzaW9sb2dpY2FsIGdlbm9taWNzPC9hYmJyLTE+PC9wZXJpb2Rp

Y2FsPjxhbHQtcGVyaW9kaWNhbD48ZnVsbC10aXRsZT5QaHlzaW9sIEdlbm9taWNzPC9mdWxsLXRp

dGxlPjxhYmJyLTE+UGh5c2lvbG9naWNhbCBnZW5vbWljczwvYWJici0xPjwvYWx0LXBlcmlvZGlj

YWw+PHBhZ2VzPjE5Ni0yMDU8L3BhZ2VzPjx2b2x1bWU+MTg8L3ZvbHVtZT48bnVtYmVyPjI8L251

bWJlcj48ZWRpdGlvbj4yMDA0LzA1LzEzPC9lZGl0aW9uPjxrZXl3b3Jkcz48a2V5d29yZD5BbWlu

byBBY2lkIE1vdGlmcy9nZW5ldGljcy9waHlzaW9sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPkFuaW1h

bHM8L2tleXdvcmQ+PGtleXdvcmQ+QmFjdGVyaWFsIFByb3RlaW5zL2NoZW1pc3RyeS9tZXRhYm9s

aXNtL3BoeXNpb2xvZ3k8L2tleXdvcmQ+PGtleXdvcmQ+Qml2YWx2aWEvZ2VuZXRpY3M8L2tleXdv

cmQ+PGtleXdvcmQ+Q0hPIENlbGxzL2NoZW1pc3RyeS9waHlzaW9sb2d5PC9rZXl3b3JkPjxrZXl3

b3JkPkNhZW5vcmhhYmRpdGlzIGVsZWdhbnMgUHJvdGVpbnMvY2hlbWlzdHJ5L21ldGFib2xpc20v

cGh5c2lvbG9neTwva2V5d29yZD48a2V5d29yZD5DZWxsIEN5Y2xlL2dlbmV0aWNzLyBwaHlzaW9s

b2d5PC9rZXl3b3JkPjxrZXl3b3JkPkNlbGwgQ3ljbGUgUHJvdGVpbnMvY2hlbWlzdHJ5L21ldGFi

b2xpc208L2tleXdvcmQ+PGtleXdvcmQ+Q2VsbCBMaW5lPC9rZXl3b3JkPjxrZXl3b3JkPkNvbXB1

dGF0aW9uYWwgQmlvbG9neS8gbWV0aG9kczwva2V5d29yZD48a2V5d29yZD5DcmljZXRpbmFlPC9r

ZXl3b3JkPjxrZXl3b3JkPkRvZ3M8L2tleXdvcmQ+PGtleXdvcmQ+RHJvc29waGlsYSBQcm90ZWlu

cy9jaGVtaXN0cnkvbWV0YWJvbGlzbS9waHlzaW9sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPkZ1bmdh

bCBQcm90ZWlucy9jaGVtaXN0cnkvbWV0YWJvbGlzbS9waHlzaW9sb2d5PC9rZXl3b3JkPjxrZXl3

b3JkPkhvcnNlcy9nZW5ldGljczwva2V5d29yZD48a2V5d29yZD5IdW1hbnM8L2tleXdvcmQ+PGtl

eXdvcmQ+TWljZTwva2V5d29yZD48a2V5d29yZD5PeGlkYXRpb24tUmVkdWN0aW9uPC9rZXl3b3Jk

PjxrZXl3b3JkPlByb3RlaW4gU3RydWN0dXJlLCBTZWNvbmRhcnkvZ2VuZXRpY3MvcGh5c2lvbG9n

eTwva2V5d29yZD48a2V5d29yZD5Qcm90b3pvYW4gUHJvdGVpbnMvY2hlbWlzdHJ5L21ldGFib2xp

c20vcGh5c2lvbG9neTwva2V5d29yZD48a2V5d29yZD5SYXRzPC9rZXl3b3JkPjxrZXl3b3JkPlNh

Y2NoYXJvbXljZXMgY2VyZXZpc2lhZSBQcm90ZWlucy9jaGVtaXN0cnkvbWV0YWJvbGlzbS9waHlz

aW9sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPlN0YXJmaXNoL2dlbmV0aWNzPC9rZXl3b3JkPjxrZXl3

b3JkPlN3aW5lL2dlbmV0aWNzPC9rZXl3b3JkPjxrZXl3b3JkPlhlbm9wdXMgUHJvdGVpbnMvY2hl

bWlzdHJ5L21ldGFib2xpc20vcGh5c2lvbG9neTwva2V5d29yZD48L2tleXdvcmRzPjxkYXRlcz48

eWVhcj4yMDA0PC95ZWFyPjxwdWItZGF0ZXM+PGRhdGU+SnVsIDg8L2RhdGU+PC9wdWItZGF0ZXM+

PC9kYXRlcz48aXNibj4xNTMxLTIyNjcgKEVsZWN0cm9uaWMpJiN4RDsxMDk0LTgzNDEgKExpbmtp

bmcpPC9pc2JuPjxhY2Nlc3Npb24tbnVtPjE1MTM4MzA3PC9hY2Nlc3Npb24tbnVtPjx1cmxzPjwv

dXJscz48ZWxlY3Ryb25pYy1yZXNvdXJjZS1udW0+MTAuMTE1Mi9waHlzaW9sZ2Vub21pY3MuMDAw

NTguMjAwNDwvZWxlY3Ryb25pYy1yZXNvdXJjZS1udW0+PHJlbW90ZS1kYXRhYmFzZS1wcm92aWRl

cj5OTE08L3JlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj48bGFuZ3VhZ2U+ZW5nPC9sYW5ndWFnZT48

L3JlY29yZD48L0NpdGU+PENpdGU+PEF1dGhvcj5TYXJzb3VyPC9BdXRob3I+PFllYXI+MjAwODwv

WWVhcj48UmVjTnVtPjU5PC9SZWNOdW0+PHJlY29yZD48cmVjLW51bWJlcj41OTwvcmVjLW51bWJl

cj48Zm9yZWlnbi1rZXlzPjxrZXkgYXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZlNnZhOXo1ZWV2Mmw1

NWFhOHN4c2E1OTllZXYycyI+NTk8L2tleT48L2ZvcmVpZ24ta2V5cz48cmVmLXR5cGUgbmFtZT0i

Sm91cm5hbCBBcnRpY2xlIj4xNzwvcmVmLXR5cGU+PGNvbnRyaWJ1dG9ycz48YXV0aG9ycz48YXV0

aG9yPlNhcnNvdXIsIEUuIEguPC9hdXRob3I+PGF1dGhvcj5WZW5rYXRhcmFtYW4sIFMuPC9hdXRo

b3I+PGF1dGhvcj5LYWxlbiwgQS4gTC48L2F1dGhvcj48YXV0aG9yPk9iZXJsZXksIEwuIFcuPC9h

dXRob3I+PGF1dGhvcj5Hb3N3YW1pLCBQLiBDLjwvYXV0aG9yPjwvYXV0aG9ycz48L2NvbnRyaWJ1

dG9ycz48YXV0aC1hZGRyZXNzPkZyZWUgUmFkaWNhbCBhbmQgUmFkaWF0aW9uIEJpb2xvZ3kgUHJv

Z3JhbSwgRGVwYXJ0bWVudCBvZiBSYWRpYXRpb24gT25jb2xvZ3ksIFVuaXZlcnNpdHkgb2YgSW93

YSwgSW93YSBDaXR5LCBJQSA1MjI0MiwgVVNBLjwvYXV0aC1hZGRyZXNzPjx0aXRsZXM+PHRpdGxl

Pk1hbmdhbmVzZSBzdXBlcm94aWRlIGRpc211dGFzZSBhY3Rpdml0eSByZWd1bGF0ZXMgdHJhbnNp

dGlvbnMgYmV0d2VlbiBxdWllc2NlbnQgYW5kIHByb2xpZmVyYXRpdmUgZ3Jvd3RoPC90aXRsZT48

c2Vjb25kYXJ5LXRpdGxlPkFnaW5nIENlbGw8L3NlY29uZGFyeS10aXRsZT48YWx0LXRpdGxlPkFn

aW5nIGNlbGw8L2FsdC10aXRsZT48L3RpdGxlcz48cGVyaW9kaWNhbD48ZnVsbC10aXRsZT5BZ2lu

ZyBDZWxsPC9mdWxsLXRpdGxlPjxhYmJyLTE+QWdpbmcgY2VsbDwvYWJici0xPjwvcGVyaW9kaWNh

bD48YWx0LXBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+QWdpbmcgQ2VsbDwvZnVsbC10aXRsZT48YWJi

ci0xPkFnaW5nIGNlbGw8L2FiYnItMT48L2FsdC1wZXJpb2RpY2FsPjxwYWdlcz40MDUtMTc8L3Bh

Z2VzPjx2b2x1bWU+Nzwvdm9sdW1lPjxudW1iZXI+MzwvbnVtYmVyPjxlZGl0aW9uPjIwMDgvMDMv

MTI8L2VkaXRpb24+PGtleXdvcmRzPjxrZXl3b3JkPkNlbGwgUHJvbGlmZXJhdGlvbjwva2V5d29y

ZD48a2V5d29yZD5DZWxscywgQ3VsdHVyZWQ8L2tleXdvcmQ+PGtleXdvcmQ+Q3ljbGluIEIvbWV0

YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5DeWNsaW4gQjE8L2tleXdvcmQ+PGtleXdvcmQ+Q3lj

bGluIEQxL21ldGFib2xpc208L2tleXdvcmQ+PGtleXdvcmQ+Rmlicm9ibGFzdHMvY3l0b2xvZ3kv

bWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5IdW1hbnM8L2tleXdvcmQ+PGtleXdvcmQ+SHlk

cm9nZW4gUGVyb3hpZGUvYW5hbHlzaXM8L2tleXdvcmQ+PGtleXdvcmQ+UmVhY3RpdmUgT3h5Z2Vu

IFNwZWNpZXMvYW5hbHlzaXMvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5TdXBlcm94aWRl

IERpc211dGFzZS9kZWZpY2llbmN5LyBtZXRhYm9saXNtPC9rZXl3b3JkPjxrZXl3b3JkPlN1cGVy

b3hpZGVzL2FuYWx5c2lzL21ldGFib2xpc208L2tleXdvcmQ+PC9rZXl3b3Jkcz48ZGF0ZXM+PHll

YXI+MjAwODwveWVhcj48cHViLWRhdGVzPjxkYXRlPkp1bjwvZGF0ZT48L3B1Yi1kYXRlcz48L2Rh

dGVzPjxpc2JuPjE0NzQtOTcyNiAoRWxlY3Ryb25pYykmI3hEOzE0NzQtOTcxOCAoTGlua2luZyk8

L2lzYm4+PGFjY2Vzc2lvbi1udW0+MTgzMzE2MTc8L2FjY2Vzc2lvbi1udW0+PHVybHM+PC91cmxz

PjxjdXN0b20yPlBNQzI1Mzg5NDU8L2N1c3RvbTI+PGN1c3RvbTY+TmlobXM1OTM3MzwvY3VzdG9t

Nj48ZWxlY3Ryb25pYy1yZXNvdXJjZS1udW0+MTAuMTExMS9qLjE0NzQtOTcyNi4yMDA4LjAwMzg0

Lng8L2VsZWN0cm9uaWMtcmVzb3VyY2UtbnVtPjxyZW1vdGUtZGF0YWJhc2UtcHJvdmlkZXI+TkxN

PC9yZW1vdGUtZGF0YWJhc2UtcHJvdmlkZXI+PGxhbmd1YWdlPmVuZzwvbGFuZ3VhZ2U+PC9yZWNv

cmQ+PC9DaXRlPjwvRW5kTm90ZT4A

ADDIN EN.CITE PEVuZE5vdGU+PENpdGU+PEF1dGhvcj5Hb3N3YW1pPC9BdXRob3I+PFllYXI+MjAwMDwvWWVhcj48

UmVjTnVtPjkyPC9SZWNOdW0+PERpc3BsYXlUZXh0PlsyNiwgNjYsIDE0OV08L0Rpc3BsYXlUZXh0

PjxyZWNvcmQ+PHJlYy1udW1iZXI+OTI8L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5IGFw

cD0iRU4iIGRiLWlkPSJ3MndmeGFmZTZ2YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjkyPC9r

ZXk+PC9mb3JlaWduLWtleXM+PHJlZi10eXBlIG5hbWU9IkpvdXJuYWwgQXJ0aWNsZSI+MTc8L3Jl

Zi10eXBlPjxjb250cmlidXRvcnM+PGF1dGhvcnM+PGF1dGhvcj5Hb3N3YW1pLCBQLiBDLjwvYXV0

aG9yPjxhdXRob3I+U2hlcmVuLCBKLjwvYXV0aG9yPjxhdXRob3I+QWxiZWUsIEwuIEQuPC9hdXRo

b3I+PGF1dGhvcj5QYXJzaWFuLCBBLjwvYXV0aG9yPjxhdXRob3I+U2ltLCBKLiBFLjwvYXV0aG9y

PjxhdXRob3I+Umlkbm91ciwgTC4gQS48L2F1dGhvcj48YXV0aG9yPkhpZ2FzaGlrdWJvLCBSLjwv

YXV0aG9yPjxhdXRob3I+R2l1cywgRC48L2F1dGhvcj48YXV0aG9yPkh1bnQsIEMuIFIuPC9hdXRo

b3I+PGF1dGhvcj5TcGl0eiwgRC4gUi48L2F1dGhvcj48L2F1dGhvcnM+PC9jb250cmlidXRvcnM+

PGF1dGgtYWRkcmVzcz5SYWRpYXRpb24gT25jb2xvZ3kgQ2VudGVyLCBNSVIsIFdhc2hpbmd0b24g

VW5pdmVyc2l0eSBNZWRpY2FsIFNjaG9vbCwgU3QuIExvdWlzLCBNaXNzb3VyaSA2MzEwOCwgVVNB

LjwvYXV0aC1hZGRyZXNzPjx0aXRsZXM+PHRpdGxlPkNlbGwgY3ljbGUtY291cGxlZCB2YXJpYXRp

b24gaW4gdG9wb2lzb21lcmFzZSBJSWFscGhhIG1STkEgaXMgcmVndWxhdGVkIGJ5IHRoZSAzJmFw

b3M7LXVudHJhbnNsYXRlZCByZWdpb24uIFBvc3NpYmxlIHJvbGUgb2YgcmVkb3gtc2Vuc2l0aXZl

IHByb3RlaW4gYmluZGluZyBpbiBtUk5BIGFjY3VtdWxhdGlvbjwvdGl0bGU+PHNlY29uZGFyeS10

aXRsZT5KIEJpb2wgQ2hlbTwvc2Vjb25kYXJ5LXRpdGxlPjxhbHQtdGl0bGU+VGhlIEpvdXJuYWwg

b2YgYmlvbG9naWNhbCBjaGVtaXN0cnk8L2FsdC10aXRsZT48L3RpdGxlcz48cGVyaW9kaWNhbD48

ZnVsbC10aXRsZT5KIEJpb2wgQ2hlbTwvZnVsbC10aXRsZT48YWJici0xPlRoZSBKb3VybmFsIG9m

IGJpb2xvZ2ljYWwgY2hlbWlzdHJ5PC9hYmJyLTE+PC9wZXJpb2RpY2FsPjxhbHQtcGVyaW9kaWNh

bD48ZnVsbC10aXRsZT5KIEJpb2wgQ2hlbTwvZnVsbC10aXRsZT48YWJici0xPlRoZSBKb3VybmFs

IG9mIGJpb2xvZ2ljYWwgY2hlbWlzdHJ5PC9hYmJyLTE+PC9hbHQtcGVyaW9kaWNhbD48cGFnZXM+

MzgzODQtOTI8L3BhZ2VzPjx2b2x1bWU+Mjc1PC92b2x1bWU+PG51bWJlcj40OTwvbnVtYmVyPjxl

ZGl0aW9uPjIwMDAvMDkvMTU8L2VkaXRpb24+PGtleXdvcmRzPjxrZXl3b3JkPjMmYXBvczsgVW50

cmFuc2xhdGVkIFJlZ2lvbnMvIGdlbmV0aWNzPC9rZXl3b3JkPjxrZXl3b3JkPjNUMyBDZWxsczwv

a2V5d29yZD48a2V5d29yZD5BbmltYWxzPC9rZXl3b3JkPjxrZXl3b3JkPkFudGlnZW5zLCBOZW9w

bGFzbTwva2V5d29yZD48a2V5d29yZD5CYXNlIFNlcXVlbmNlPC9rZXl3b3JkPjxrZXl3b3JkPkNl

bGwgQ3ljbGUvIHBoeXNpb2xvZ3k8L2tleXdvcmQ+PGtleXdvcmQ+RE5BIFRvcG9pc29tZXJhc2Vz

LCBUeXBlIElJLyBnZW5ldGljczwva2V5d29yZD48a2V5d29yZD5ETkEtQmluZGluZyBQcm90ZWlu

czwva2V5d29yZD48a2V5d29yZD5HZW5lIEV4cHJlc3Npb24gUmVndWxhdGlvbiwgRW56eW1vbG9n

aWM8L2tleXdvcmQ+PGtleXdvcmQ+R2VuZXMsIFJlcG9ydGVyPC9rZXl3b3JkPjxrZXl3b3JkPkdl

bmV0aWMgVmFyaWF0aW9uPC9rZXl3b3JkPjxrZXl3b3JkPkhlTGEgQ2VsbHM8L2tleXdvcmQ+PGtl

eXdvcmQ+SHVtYW5zPC9rZXl3b3JkPjxrZXl3b3JkPklzb2VuenltZXMvIGdlbmV0aWNzPC9rZXl3

b3JkPjxrZXl3b3JkPk1hbW1hbHM8L2tleXdvcmQ+PGtleXdvcmQ+TWljZTwva2V5d29yZD48a2V5

d29yZD5Nb2xlY3VsYXIgU2VxdWVuY2UgRGF0YTwva2V5d29yZD48a2V5d29yZD5STkEsIE1lc3Nl

bmdlci8gZ2VuZXRpY3M8L2tleXdvcmQ+PGtleXdvcmQ+Uk5BLUJpbmRpbmcgUHJvdGVpbnMvbWV0

YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5SZWNvbWJpbmFudCBQcm90ZWlucy9iaW9zeW50aGVz

aXM8L2tleXdvcmQ+PGtleXdvcmQ+VHJhbnNjcmlwdGlvbiwgR2VuZXRpYzwva2V5d29yZD48a2V5

d29yZD5UcmFuc2ZlY3Rpb248L2tleXdvcmQ+PGtleXdvcmQ+VWx0cmF2aW9sZXQgUmF5czwva2V5

d29yZD48L2tleXdvcmRzPjxkYXRlcz48eWVhcj4yMDAwPC95ZWFyPjxwdWItZGF0ZXM+PGRhdGU+

RGVjIDg8L2RhdGU+PC9wdWItZGF0ZXM+PC9kYXRlcz48aXNibj4wMDIxLTkyNTggKFByaW50KSYj

eEQ7MDAyMS05MjU4IChMaW5raW5nKTwvaXNibj48YWNjZXNzaW9uLW51bT4xMDk4NjI4MzwvYWNj

ZXNzaW9uLW51bT48dXJscz48L3VybHM+PGVsZWN0cm9uaWMtcmVzb3VyY2UtbnVtPjEwLjEwNzQv

amJjLk0wMDUyOTgyMDA8L2VsZWN0cm9uaWMtcmVzb3VyY2UtbnVtPjxyZW1vdGUtZGF0YWJhc2Ut

cHJvdmlkZXI+TkxNPC9yZW1vdGUtZGF0YWJhc2UtcHJvdmlkZXI+PGxhbmd1YWdlPmVuZzwvbGFu

Z3VhZ2U+PC9yZWNvcmQ+PC9DaXRlPjxDaXRlPjxBdXRob3I+Q29ub3VyPC9BdXRob3I+PFllYXI+

MjAwNDwvWWVhcj48UmVjTnVtPjM1PC9SZWNOdW0+PHJlY29yZD48cmVjLW51bWJlcj4zNTwvcmVj

LW51bWJlcj48Zm9yZWlnbi1rZXlzPjxrZXkgYXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZlNnZhOXo1

ZWV2Mmw1NWFhOHN4c2E1OTllZXYycyI+MzU8L2tleT48L2ZvcmVpZ24ta2V5cz48cmVmLXR5cGUg

bmFtZT0iSm91cm5hbCBBcnRpY2xlIj4xNzwvcmVmLXR5cGU+PGNvbnRyaWJ1dG9ycz48YXV0aG9y

cz48YXV0aG9yPkNvbm91ciwgSi4gRS48L2F1dGhvcj48YXV0aG9yPkdyYWhhbSwgVy4gVi48L2F1

dGhvcj48YXV0aG9yPkdhc2tpbnMsIEguIFIuPC9hdXRob3I+PC9hdXRob3JzPjwvY29udHJpYnV0

b3JzPjxhdXRoLWFkZHJlc3M+RGVwYXJ0bWVudCBvZiBBbmltYWwgU2NpZW5jZXMsIFVuaXZlcnNp

dHkgb2YgSWxsaW5vaXMsIFVyYmFuYSwgSWxsaW5vaXMgNjE4MDEsIFVTQS48L2F1dGgtYWRkcmVz

cz48dGl0bGVzPjx0aXRsZT5BIGNvbWJpbmVkIGluIHZpdHJvL2Jpb2luZm9ybWF0aWMgaW52ZXN0

aWdhdGlvbiBvZiByZWRveCByZWd1bGF0b3J5IG1lY2hhbmlzbXMgZ292ZXJuaW5nIGNlbGwgY3lj

bGUgcHJvZ3Jlc3Npb248L3RpdGxlPjxzZWNvbmRhcnktdGl0bGU+UGh5c2lvbCBHZW5vbWljczwv

c2Vjb25kYXJ5LXRpdGxlPjxhbHQtdGl0bGU+UGh5c2lvbG9naWNhbCBnZW5vbWljczwvYWx0LXRp

dGxlPjwvdGl0bGVzPjxwZXJpb2RpY2FsPjxmdWxsLXRpdGxlPlBoeXNpb2wgR2Vub21pY3M8L2Z1

bGwtdGl0bGU+PGFiYnItMT5QaHlzaW9sb2dpY2FsIGdlbm9taWNzPC9hYmJyLTE+PC9wZXJpb2Rp

Y2FsPjxhbHQtcGVyaW9kaWNhbD48ZnVsbC10aXRsZT5QaHlzaW9sIEdlbm9taWNzPC9mdWxsLXRp

dGxlPjxhYmJyLTE+UGh5c2lvbG9naWNhbCBnZW5vbWljczwvYWJici0xPjwvYWx0LXBlcmlvZGlj

YWw+PHBhZ2VzPjE5Ni0yMDU8L3BhZ2VzPjx2b2x1bWU+MTg8L3ZvbHVtZT48bnVtYmVyPjI8L251

bWJlcj48ZWRpdGlvbj4yMDA0LzA1LzEzPC9lZGl0aW9uPjxrZXl3b3Jkcz48a2V5d29yZD5BbWlu

byBBY2lkIE1vdGlmcy9nZW5ldGljcy9waHlzaW9sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPkFuaW1h

bHM8L2tleXdvcmQ+PGtleXdvcmQ+QmFjdGVyaWFsIFByb3RlaW5zL2NoZW1pc3RyeS9tZXRhYm9s

aXNtL3BoeXNpb2xvZ3k8L2tleXdvcmQ+PGtleXdvcmQ+Qml2YWx2aWEvZ2VuZXRpY3M8L2tleXdv

cmQ+PGtleXdvcmQ+Q0hPIENlbGxzL2NoZW1pc3RyeS9waHlzaW9sb2d5PC9rZXl3b3JkPjxrZXl3

b3JkPkNhZW5vcmhhYmRpdGlzIGVsZWdhbnMgUHJvdGVpbnMvY2hlbWlzdHJ5L21ldGFib2xpc20v

cGh5c2lvbG9neTwva2V5d29yZD48a2V5d29yZD5DZWxsIEN5Y2xlL2dlbmV0aWNzLyBwaHlzaW9s

b2d5PC9rZXl3b3JkPjxrZXl3b3JkPkNlbGwgQ3ljbGUgUHJvdGVpbnMvY2hlbWlzdHJ5L21ldGFi

b2xpc208L2tleXdvcmQ+PGtleXdvcmQ+Q2VsbCBMaW5lPC9rZXl3b3JkPjxrZXl3b3JkPkNvbXB1

dGF0aW9uYWwgQmlvbG9neS8gbWV0aG9kczwva2V5d29yZD48a2V5d29yZD5DcmljZXRpbmFlPC9r

ZXl3b3JkPjxrZXl3b3JkPkRvZ3M8L2tleXdvcmQ+PGtleXdvcmQ+RHJvc29waGlsYSBQcm90ZWlu

cy9jaGVtaXN0cnkvbWV0YWJvbGlzbS9waHlzaW9sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPkZ1bmdh

bCBQcm90ZWlucy9jaGVtaXN0cnkvbWV0YWJvbGlzbS9waHlzaW9sb2d5PC9rZXl3b3JkPjxrZXl3

b3JkPkhvcnNlcy9nZW5ldGljczwva2V5d29yZD48a2V5d29yZD5IdW1hbnM8L2tleXdvcmQ+PGtl

eXdvcmQ+TWljZTwva2V5d29yZD48a2V5d29yZD5PeGlkYXRpb24tUmVkdWN0aW9uPC9rZXl3b3Jk

PjxrZXl3b3JkPlByb3RlaW4gU3RydWN0dXJlLCBTZWNvbmRhcnkvZ2VuZXRpY3MvcGh5c2lvbG9n

eTwva2V5d29yZD48a2V5d29yZD5Qcm90b3pvYW4gUHJvdGVpbnMvY2hlbWlzdHJ5L21ldGFib2xp

c20vcGh5c2lvbG9neTwva2V5d29yZD48a2V5d29yZD5SYXRzPC9rZXl3b3JkPjxrZXl3b3JkPlNh

Y2NoYXJvbXljZXMgY2VyZXZpc2lhZSBQcm90ZWlucy9jaGVtaXN0cnkvbWV0YWJvbGlzbS9waHlz

aW9sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPlN0YXJmaXNoL2dlbmV0aWNzPC9rZXl3b3JkPjxrZXl3

b3JkPlN3aW5lL2dlbmV0aWNzPC9rZXl3b3JkPjxrZXl3b3JkPlhlbm9wdXMgUHJvdGVpbnMvY2hl

bWlzdHJ5L21ldGFib2xpc20vcGh5c2lvbG9neTwva2V5d29yZD48L2tleXdvcmRzPjxkYXRlcz48

eWVhcj4yMDA0PC95ZWFyPjxwdWItZGF0ZXM+PGRhdGU+SnVsIDg8L2RhdGU+PC9wdWItZGF0ZXM+

PC9kYXRlcz48aXNibj4xNTMxLTIyNjcgKEVsZWN0cm9uaWMpJiN4RDsxMDk0LTgzNDEgKExpbmtp

bmcpPC9pc2JuPjxhY2Nlc3Npb24tbnVtPjE1MTM4MzA3PC9hY2Nlc3Npb24tbnVtPjx1cmxzPjwv

dXJscz48ZWxlY3Ryb25pYy1yZXNvdXJjZS1udW0+MTAuMTE1Mi9waHlzaW9sZ2Vub21pY3MuMDAw

NTguMjAwNDwvZWxlY3Ryb25pYy1yZXNvdXJjZS1udW0+PHJlbW90ZS1kYXRhYmFzZS1wcm92aWRl

cj5OTE08L3JlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj48bGFuZ3VhZ2U+ZW5nPC9sYW5ndWFnZT48

L3JlY29yZD48L0NpdGU+PENpdGU+PEF1dGhvcj5TYXJzb3VyPC9BdXRob3I+PFllYXI+MjAwODwv

WWVhcj48UmVjTnVtPjU5PC9SZWNOdW0+PHJlY29yZD48cmVjLW51bWJlcj41OTwvcmVjLW51bWJl

cj48Zm9yZWlnbi1rZXlzPjxrZXkgYXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZlNnZhOXo1ZWV2Mmw1

NWFhOHN4c2E1OTllZXYycyI+NTk8L2tleT48L2ZvcmVpZ24ta2V5cz48cmVmLXR5cGUgbmFtZT0i

Sm91cm5hbCBBcnRpY2xlIj4xNzwvcmVmLXR5cGU+PGNvbnRyaWJ1dG9ycz48YXV0aG9ycz48YXV0

aG9yPlNhcnNvdXIsIEUuIEguPC9hdXRob3I+PGF1dGhvcj5WZW5rYXRhcmFtYW4sIFMuPC9hdXRo

b3I+PGF1dGhvcj5LYWxlbiwgQS4gTC48L2F1dGhvcj48YXV0aG9yPk9iZXJsZXksIEwuIFcuPC9h

dXRob3I+PGF1dGhvcj5Hb3N3YW1pLCBQLiBDLjwvYXV0aG9yPjwvYXV0aG9ycz48L2NvbnRyaWJ1

dG9ycz48YXV0aC1hZGRyZXNzPkZyZWUgUmFkaWNhbCBhbmQgUmFkaWF0aW9uIEJpb2xvZ3kgUHJv

Z3JhbSwgRGVwYXJ0bWVudCBvZiBSYWRpYXRpb24gT25jb2xvZ3ksIFVuaXZlcnNpdHkgb2YgSW93

YSwgSW93YSBDaXR5LCBJQSA1MjI0MiwgVVNBLjwvYXV0aC1hZGRyZXNzPjx0aXRsZXM+PHRpdGxl

Pk1hbmdhbmVzZSBzdXBlcm94aWRlIGRpc211dGFzZSBhY3Rpdml0eSByZWd1bGF0ZXMgdHJhbnNp

dGlvbnMgYmV0d2VlbiBxdWllc2NlbnQgYW5kIHByb2xpZmVyYXRpdmUgZ3Jvd3RoPC90aXRsZT48

c2Vjb25kYXJ5LXRpdGxlPkFnaW5nIENlbGw8L3NlY29uZGFyeS10aXRsZT48YWx0LXRpdGxlPkFn

aW5nIGNlbGw8L2FsdC10aXRsZT48L3RpdGxlcz48cGVyaW9kaWNhbD48ZnVsbC10aXRsZT5BZ2lu

ZyBDZWxsPC9mdWxsLXRpdGxlPjxhYmJyLTE+QWdpbmcgY2VsbDwvYWJici0xPjwvcGVyaW9kaWNh

bD48YWx0LXBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+QWdpbmcgQ2VsbDwvZnVsbC10aXRsZT48YWJi

ci0xPkFnaW5nIGNlbGw8L2FiYnItMT48L2FsdC1wZXJpb2RpY2FsPjxwYWdlcz40MDUtMTc8L3Bh

Z2VzPjx2b2x1bWU+Nzwvdm9sdW1lPjxudW1iZXI+MzwvbnVtYmVyPjxlZGl0aW9uPjIwMDgvMDMv

MTI8L2VkaXRpb24+PGtleXdvcmRzPjxrZXl3b3JkPkNlbGwgUHJvbGlmZXJhdGlvbjwva2V5d29y

ZD48a2V5d29yZD5DZWxscywgQ3VsdHVyZWQ8L2tleXdvcmQ+PGtleXdvcmQ+Q3ljbGluIEIvbWV0

YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5DeWNsaW4gQjE8L2tleXdvcmQ+PGtleXdvcmQ+Q3lj

bGluIEQxL21ldGFib2xpc208L2tleXdvcmQ+PGtleXdvcmQ+Rmlicm9ibGFzdHMvY3l0b2xvZ3kv

bWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5IdW1hbnM8L2tleXdvcmQ+PGtleXdvcmQ+SHlk

cm9nZW4gUGVyb3hpZGUvYW5hbHlzaXM8L2tleXdvcmQ+PGtleXdvcmQ+UmVhY3RpdmUgT3h5Z2Vu

IFNwZWNpZXMvYW5hbHlzaXMvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5TdXBlcm94aWRl

IERpc211dGFzZS9kZWZpY2llbmN5LyBtZXRhYm9saXNtPC9rZXl3b3JkPjxrZXl3b3JkPlN1cGVy

b3hpZGVzL2FuYWx5c2lzL21ldGFib2xpc208L2tleXdvcmQ+PC9rZXl3b3Jkcz48ZGF0ZXM+PHll

YXI+MjAwODwveWVhcj48cHViLWRhdGVzPjxkYXRlPkp1bjwvZGF0ZT48L3B1Yi1kYXRlcz48L2Rh

dGVzPjxpc2JuPjE0NzQtOTcyNiAoRWxlY3Ryb25pYykmI3hEOzE0NzQtOTcxOCAoTGlua2luZyk8

L2lzYm4+PGFjY2Vzc2lvbi1udW0+MTgzMzE2MTc8L2FjY2Vzc2lvbi1udW0+PHVybHM+PC91cmxz

PjxjdXN0b20yPlBNQzI1Mzg5NDU8L2N1c3RvbTI+PGN1c3RvbTY+TmlobXM1OTM3MzwvY3VzdG9t

Nj48ZWxlY3Ryb25pYy1yZXNvdXJjZS1udW0+MTAuMTExMS9qLjE0NzQtOTcyNi4yMDA4LjAwMzg0

Lng8L2VsZWN0cm9uaWMtcmVzb3VyY2UtbnVtPjxyZW1vdGUtZGF0YWJhc2UtcHJvdmlkZXI+TkxN

PC9yZW1vdGUtZGF0YWJhc2UtcHJvdmlkZXI+PGxhbmd1YWdlPmVuZzwvbGFuZ3VhZ2U+PC9yZWNv

cmQ+PC9DaXRlPjwvRW5kTm90ZT4A

ADDIN EN.CITE.DATA [26, 66, 149]. Принимая во внимание способность карнозина взаимодействовать с некоторыми видами АФК и снижать их реакционную способность PEVuZE5vdGU+PENpdGU+PEF1dGhvcj5EdXBpbjwvQXV0aG9yPjxZZWFyPjE5ODQ8L1llYXI+PFJl

Y051bT4xMTM8L1JlY051bT48RGlzcGxheVRleHQ+WzE1LTE5XTwvRGlzcGxheVRleHQ+PHJlY29y

ZD48cmVjLW51bWJlcj4xMTM8L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5IGFwcD0iRU4i

IGRiLWlkPSJ3MndmeGFmZTZ2YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjExMzwva2V5Pjwv

Zm9yZWlnbi1rZXlzPjxyZWYtdHlwZSBuYW1lPSJKb3VybmFsIEFydGljbGUiPjE3PC9yZWYtdHlw

ZT48Y29udHJpYnV0b3JzPjxhdXRob3JzPjxhdXRob3I+RHVwaW4sIEEuIE0uPC9hdXRob3I+PGF1

dGhvcj5Cb2xkeXJldiwgQS4gQS48L2F1dGhvcj48YXV0aG9yPkFya2hpcGVua28gSXUsIFYuPC9h

dXRob3I+PGF1dGhvcj5LYWdhbiwgVi4gRS48L2F1dGhvcj48L2F1dGhvcnM+PC9jb250cmlidXRv

cnM+PHRpdGxlcz48dGl0bGU+W0Nhcm5vc2luZSBwcm90ZWN0aW9uIG9mIENhMisgdHJhbnNwb3J0

IGFnYWluc3QgZGFtYWdlIGluZHVjZWQgYnkgbGlwaWQgcGVyb3hpZGF0aW9uXTwvdGl0bGU+PHNl

Y29uZGFyeS10aXRsZT5CaXVsbCBFa3NwIEJpb2wgTWVkPC9zZWNvbmRhcnktdGl0bGU+PGFsdC10

aXRsZT5CaXVsbGV0ZW4mYXBvczsgZWtzcGVyaW1lbnRhbCZhcG9zO25vaSBiaW9sb2dpaSBpIG1l

ZGl0c2lueTwvYWx0LXRpdGxlPjwvdGl0bGVzPjxwZXJpb2RpY2FsPjxmdWxsLXRpdGxlPkJpdWxs

IEVrc3AgQmlvbCBNZWQ8L2Z1bGwtdGl0bGU+PGFiYnItMT5CaXVsbGV0ZW4mYXBvczsgZWtzcGVy

aW1lbnRhbCZhcG9zO25vaSBiaW9sb2dpaSBpIG1lZGl0c2lueTwvYWJici0xPjwvcGVyaW9kaWNh

bD48YWx0LXBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+Qml1bGwgRWtzcCBCaW9sIE1lZDwvZnVsbC10

aXRsZT48YWJici0xPkJpdWxsZXRlbiZhcG9zOyBla3NwZXJpbWVudGFsJmFwb3M7bm9pIGJpb2xv

Z2lpIGkgbWVkaXRzaW55PC9hYmJyLTE+PC9hbHQtcGVyaW9kaWNhbD48cGFnZXM+MTg2LTg8L3Bh

Z2VzPjx2b2x1bWU+OTg8L3ZvbHVtZT48bnVtYmVyPjg8L251bWJlcj48ZWRpdGlvbj4xOTg0LzA4

LzAxPC9lZGl0aW9uPjxrZXl3b3Jkcz48a2V5d29yZD5BbmltYWxzPC9rZXl3b3JkPjxrZXl3b3Jk

PkJpb2xvZ2ljYWwgVHJhbnNwb3J0L2RydWcgZWZmZWN0czwva2V5d29yZD48a2V5d29yZD5DYWxj

aXVtLyBtZXRhYm9saXNtPC9rZXl3b3JkPjxrZXl3b3JkPkNhcm5vc2luZS8gcGhhcm1hY29sb2d5

PC9rZXl3b3JkPjxrZXl3b3JkPkRpcGVwdGlkZXMvIHBoYXJtYWNvbG9neTwva2V5d29yZD48a2V5

d29yZD5MaXBpZCBQZXJveGlkZXMvIG1ldGFib2xpc208L2tleXdvcmQ+PGtleXdvcmQ+TXVzY2xl

cy9kcnVnIGVmZmVjdHMvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5PeGlkYXRpb24tUmVk

dWN0aW9uL2RydWcgZWZmZWN0czwva2V5d29yZD48a2V5d29yZD5SYW5hIHRlbXBvcmFyaWE8L2tl

eXdvcmQ+PGtleXdvcmQ+U2FyY29wbGFzbWljIFJldGljdWx1bS9kcnVnIGVmZmVjdHMvbWV0YWJv

bGlzbTwva2V5d29yZD48L2tleXdvcmRzPjxkYXRlcz48eWVhcj4xOTg0PC95ZWFyPjxwdWItZGF0

ZXM+PGRhdGU+QXVnPC9kYXRlPjwvcHViLWRhdGVzPjwvZGF0ZXM+PG9yaWctcHViPlphc2hjaGl0

YSBrYXJub3ppbm9tIHRyYW5zcG9ydGEgQ2EyKyBvdCBwb3ZyZXpoZGVuaWksIHZ5enl2YWVteWto

IHBlcmVraXNueW0gb2tpc2xlbmllbSBsaXBpZG92Ljwvb3JpZy1wdWI+PGlzYm4+MDM2NS05NjE1

IChQcmludCkmI3hEOzAzNjUtOTYxNSAoTGlua2luZyk8L2lzYm4+PGFjY2Vzc2lvbi1udW0+NjMz

MTg2MjwvYWNjZXNzaW9uLW51bT48dXJscz48L3VybHM+PHJlbW90ZS1kYXRhYmFzZS1wcm92aWRl

cj5OTE08L3JlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj48bGFuZ3VhZ2U+cnVzPC9sYW5ndWFnZT48

L3JlY29yZD48L0NpdGU+PENpdGU+PEF1dGhvcj5Lb2hlbjwvQXV0aG9yPjxZZWFyPjE5ODg8L1ll

YXI+PFJlY051bT4xMDA8L1JlY051bT48cmVjb3JkPjxyZWMtbnVtYmVyPjEwMDwvcmVjLW51bWJl

cj48Zm9yZWlnbi1rZXlzPjxrZXkgYXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZlNnZhOXo1ZWV2Mmw1

NWFhOHN4c2E1OTllZXYycyI+MTAwPC9rZXk+PC9mb3JlaWduLWtleXM+PHJlZi10eXBlIG5hbWU9

IkpvdXJuYWwgQXJ0aWNsZSI+MTc8L3JlZi10eXBlPjxjb250cmlidXRvcnM+PGF1dGhvcnM+PGF1

dGhvcj5Lb2hlbiwgUi48L2F1dGhvcj48YXV0aG9yPllhbWFtb3RvLCBZLjwvYXV0aG9yPjxhdXRo

b3I+Q3VuZHksIEsuIEMuPC9hdXRob3I+PGF1dGhvcj5BbWVzLCBCLiBOLjwvYXV0aG9yPjwvYXV0

aG9ycz48L2NvbnRyaWJ1dG9ycz48YXV0aC1hZGRyZXNzPkRlcGFydG1lbnQgb2YgQmlvY2hlbWlz

dHJ5LCBVbml2ZXJzaXR5IG9mIENhbGlmb3JuaWEsIEJlcmtlbGV5IDk0NzIwLjwvYXV0aC1hZGRy

ZXNzPjx0aXRsZXM+PHRpdGxlPkFudGlveGlkYW50IGFjdGl2aXR5IG9mIGNhcm5vc2luZSwgaG9t

b2Nhcm5vc2luZSwgYW5kIGFuc2VyaW5lIHByZXNlbnQgaW4gbXVzY2xlIGFuZCBicmFpbjwvdGl0

bGU+PHNlY29uZGFyeS10aXRsZT5Qcm9jIE5hdGwgQWNhZCBTY2kgVSBTIEE8L3NlY29uZGFyeS10

aXRsZT48YWx0LXRpdGxlPlByb2NlZWRpbmdzIG9mIHRoZSBOYXRpb25hbCBBY2FkZW15IG9mIFNj

aWVuY2VzIG9mIHRoZSBVbml0ZWQgU3RhdGVzIG9mIEFtZXJpY2E8L2FsdC10aXRsZT48L3RpdGxl

cz48cGVyaW9kaWNhbD48ZnVsbC10aXRsZT5Qcm9jIE5hdGwgQWNhZCBTY2kgVSBTIEE8L2Z1bGwt

dGl0bGU+PGFiYnItMT5Qcm9jZWVkaW5ncyBvZiB0aGUgTmF0aW9uYWwgQWNhZGVteSBvZiBTY2ll

bmNlcyBvZiB0aGUgVW5pdGVkIFN0YXRlcyBvZiBBbWVyaWNhPC9hYmJyLTE+PC9wZXJpb2RpY2Fs

PjxhbHQtcGVyaW9kaWNhbD48ZnVsbC10aXRsZT5Qcm9jIE5hdGwgQWNhZCBTY2kgVSBTIEE8L2Z1

bGwtdGl0bGU+PGFiYnItMT5Qcm9jZWVkaW5ncyBvZiB0aGUgTmF0aW9uYWwgQWNhZGVteSBvZiBT

Y2llbmNlcyBvZiB0aGUgVW5pdGVkIFN0YXRlcyBvZiBBbWVyaWNhPC9hYmJyLTE+PC9hbHQtcGVy

aW9kaWNhbD48cGFnZXM+MzE3NS05PC9wYWdlcz48dm9sdW1lPjg1PC92b2x1bWU+PG51bWJlcj45

PC9udW1iZXI+PGVkaXRpb24+MTk4OC8wNS8wMTwvZWRpdGlvbj48a2V5d29yZHM+PGtleXdvcmQ+

QW1pZGluZXMvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5BbnNlcmluZS8gcGhhcm1hY29s

b2d5PC9rZXl3b3JkPjxrZXl3b3JkPkFudGlveGlkYW50cy8gcGhhcm1hY29sb2d5PC9rZXl3b3Jk

PjxrZXl3b3JkPkF6byBDb21wb3VuZHMvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5CcmFp

bi8gbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5DYXJub3NpbmUvYW5hbG9ncyAmYW1wOyBk

ZXJpdmF0aXZlcy8gcGhhcm1hY29sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPkNocm9tYXRvZ3JhcGh5

LCBIaWdoIFByZXNzdXJlIExpcXVpZDwva2V5d29yZD48a2V5d29yZD5EZW94eWd1YW5vc2luZS9t

ZXRhYm9saXNtPC9rZXl3b3JkPjxrZXl3b3JkPkRpcGVwdGlkZXMvIHBoYXJtYWNvbG9neTwva2V5

d29yZD48a2V5d29yZD5FbGVjdHJvY2hlbWlzdHJ5PC9rZXl3b3JkPjxrZXl3b3JkPkZyZWUgUmFk

aWNhbHM8L2tleXdvcmQ+PGtleXdvcmQ+SGlzdGlkaW5lL2FuYWxvZ3MgJmFtcDsgZGVyaXZhdGl2

ZXMvcGhhcm1hY29sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPkxpcGlkIFBlcm94aWRlcy9tZXRhYm9s

aXNtPC9rZXl3b3JkPjxrZXl3b3JkPk11c2NsZXMvIG1ldGFib2xpc208L2tleXdvcmQ+PGtleXdv

cmQ+Tml0cmlsZXMvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5Tb2x1dGlvbnM8L2tleXdv

cmQ+PGtleXdvcmQ+U3RydWN0dXJlLUFjdGl2aXR5IFJlbGF0aW9uc2hpcDwva2V5d29yZD48L2tl

eXdvcmRzPjxkYXRlcz48eWVhcj4xOTg4PC95ZWFyPjxwdWItZGF0ZXM+PGRhdGU+TWF5PC9kYXRl

PjwvcHViLWRhdGVzPjwvZGF0ZXM+PGlzYm4+MDAyNy04NDI0IChQcmludCkmI3hEOzAwMjctODQy

NCAoTGlua2luZyk8L2lzYm4+PGFjY2Vzc2lvbi1udW0+MzM2Mjg2NjwvYWNjZXNzaW9uLW51bT48

dXJscz48L3VybHM+PGN1c3RvbTI+UE1DMjgwMTY2PC9jdXN0b20yPjxyZW1vdGUtZGF0YWJhc2Ut

cHJvdmlkZXI+TkxNPC9yZW1vdGUtZGF0YWJhc2UtcHJvdmlkZXI+PGxhbmd1YWdlPmVuZzwvbGFu

Z3VhZ2U+PC9yZWNvcmQ+PC9DaXRlPjxDaXRlPjxBdXRob3I+S2xlYmFub3Y8L0F1dGhvcj48WWVh

cj4xOTk3PC9ZZWFyPjxSZWNOdW0+MTQ0PC9SZWNOdW0+PHJlY29yZD48cmVjLW51bWJlcj4xNDQ8

L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5IGFwcD0iRU4iIGRiLWlkPSJ3MndmeGFmZTZ2

YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjE0NDwva2V5PjwvZm9yZWlnbi1rZXlzPjxyZWYt

dHlwZSBuYW1lPSJKb3VybmFsIEFydGljbGUiPjE3PC9yZWYtdHlwZT48Y29udHJpYnV0b3JzPjxh

dXRob3JzPjxhdXRob3I+S2xlYmFub3YsIEcuIEkuPC9hdXRob3I+PGF1dGhvcj5UZXNlbGtpbiBZ

dSwgTy48L2F1dGhvcj48YXV0aG9yPkJhYmVua292YSwgSS4gVi48L2F1dGhvcj48YXV0aG9yPlBv

cG92LCBJLiBOLjwvYXV0aG9yPjxhdXRob3I+TGV2aW4sIEcuPC9hdXRob3I+PGF1dGhvcj5UeXVs

aW5hLCBPLiBWLjwvYXV0aG9yPjxhdXRob3I+Qm9sZHlyZXYsIEEuIEEuPC9hdXRob3I+PGF1dGhv

cj5WbGFkaW1pcm92IFl1LCBBLjwvYXV0aG9yPjwvYXV0aG9ycz48L2NvbnRyaWJ1dG9ycz48YXV0

aC1hZGRyZXNzPlJ1c3NpYW4gU3RhdGUgTWVkaWNhbCBVbml2ZXJzaXR5LCBNb3Njb3csIFJ1c3Np

YS48L2F1dGgtYWRkcmVzcz48dGl0bGVzPjx0aXRsZT5FdmlkZW5jZSBmb3IgYSBkaXJlY3QgaW50

ZXJhY3Rpb24gb2Ygc3VwZXJveGlkZSBhbmlvbiByYWRpY2FsIHdpdGggY2Fybm9zaW5lPC90aXRs

ZT48c2Vjb25kYXJ5LXRpdGxlPkJpb2NoZW0gTW9sIEJpb2wgSW50PC9zZWNvbmRhcnktdGl0bGU+

PGFsdC10aXRsZT5CaW9jaGVtaXN0cnkgYW5kIG1vbGVjdWxhciBiaW9sb2d5IGludGVybmF0aW9u

YWw8L2FsdC10aXRsZT48L3RpdGxlcz48cGVyaW9kaWNhbD48ZnVsbC10aXRsZT5CaW9jaGVtIE1v

bCBCaW9sIEludDwvZnVsbC10aXRsZT48YWJici0xPkJpb2NoZW1pc3RyeSBhbmQgbW9sZWN1bGFy

IGJpb2xvZ3kgaW50ZXJuYXRpb25hbDwvYWJici0xPjwvcGVyaW9kaWNhbD48YWx0LXBlcmlvZGlj

YWw+PGZ1bGwtdGl0bGU+QmlvY2hlbSBNb2wgQmlvbCBJbnQ8L2Z1bGwtdGl0bGU+PGFiYnItMT5C

aW9jaGVtaXN0cnkgYW5kIG1vbGVjdWxhciBiaW9sb2d5IGludGVybmF0aW9uYWw8L2FiYnItMT48

L2FsdC1wZXJpb2RpY2FsPjxwYWdlcz45OS0xMDY8L3BhZ2VzPjx2b2x1bWU+NDM8L3ZvbHVtZT48

bnVtYmVyPjE8L251bWJlcj48ZWRpdGlvbj4xOTk3LzEwLzA3PC9lZGl0aW9uPjxrZXl3b3Jkcz48

a2V5d29yZD5DYXJub3NpbmUvIG1ldGFib2xpc20vcGhhcm1hY29sb2d5PC9rZXl3b3JkPjxrZXl3

b3JkPkx1bWluZXNjZW50IE1lYXN1cmVtZW50czwva2V5d29yZD48a2V5d29yZD5MdW1pbm9sL21l

dGFib2xpc208L2tleXdvcmQ+PGtleXdvcmQ+Tml0cm9ibHVlIFRldHJhem9saXVtL21ldGFib2xp

c208L2tleXdvcmQ+PGtleXdvcmQ+T3hpZGF0aW9uLVJlZHVjdGlvbjwva2V5d29yZD48a2V5d29y

ZD5TdXBlcm94aWRlcy8gbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5YYW50aGluZSBPeGlk

YXNlL21ldGFib2xpc208L2tleXdvcmQ+PC9rZXl3b3Jkcz48ZGF0ZXM+PHllYXI+MTk5NzwveWVh

cj48cHViLWRhdGVzPjxkYXRlPlNlcDwvZGF0ZT48L3B1Yi1kYXRlcz48L2RhdGVzPjxpc2JuPjEw

MzktOTcxMiAoUHJpbnQpJiN4RDsxMDM5LTk3MTIgKExpbmtpbmcpPC9pc2JuPjxhY2Nlc3Npb24t

bnVtPjkzMTUyODc8L2FjY2Vzc2lvbi1udW0+PHVybHM+PC91cmxzPjxyZW1vdGUtZGF0YWJhc2Ut

cHJvdmlkZXI+TkxNPC9yZW1vdGUtZGF0YWJhc2UtcHJvdmlkZXI+PGxhbmd1YWdlPmVuZzwvbGFu

Z3VhZ2U+PC9yZWNvcmQ+PC9DaXRlPjxDaXRlPjxBdXRob3I+Q2hhbjwvQXV0aG9yPjxZZWFyPjE5

OTQ8L1llYXI+PFJlY051bT4xNDU8L1JlY051bT48cmVjb3JkPjxyZWMtbnVtYmVyPjE0NTwvcmVj

LW51bWJlcj48Zm9yZWlnbi1rZXlzPjxrZXkgYXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZlNnZhOXo1

ZWV2Mmw1NWFhOHN4c2E1OTllZXYycyI+MTQ1PC9rZXk+PC9mb3JlaWduLWtleXM+PHJlZi10eXBl

IG5hbWU9IkpvdXJuYWwgQXJ0aWNsZSI+MTc8L3JlZi10eXBlPjxjb250cmlidXRvcnM+PGF1dGhv

cnM+PGF1dGhvcj5DaGFuLCBXLiBLLiBNLiwgPC9hdXRob3I+PGF1dGhvcj5EZWNrZXIsIEUuIEEu

LCA8L2F1dGhvcj48YXV0aG9yPkxlZSwgSi4gQi4sIDwvYXV0aG9yPjxhdXRob3I+QnV0dGVyZmll

bGQsIEQuIEEuIDwvYXV0aG9yPjwvYXV0aG9ycz48L2NvbnRyaWJ1dG9ycz48dGl0bGVzPjx0aXRs

ZT5FUFIgc3Bpbi10cmFwcGluZyBzdHVkaWVzIG9mIHRoZSBoeWRyb3h5bCByYWRpY2FsIHNjYXZl

bmdpbmcgYWN0aXZpdHkgb2YgY2Fybm9zaW5lIGFuZCByZWxhdGVkIGRpcGVwdGlkZXM8L3RpdGxl

PjxzZWNvbmRhcnktdGl0bGU+SiBBZ3JpYyBGb29kIENoZW08L3NlY29uZGFyeS10aXRsZT48L3Rp

dGxlcz48cGVyaW9kaWNhbD48ZnVsbC10aXRsZT5KIEFncmljIEZvb2QgQ2hlbTwvZnVsbC10aXRs

ZT48YWJici0xPkpvdXJuYWwgb2YgYWdyaWN1bHR1cmFsIGFuZCBmb29kIGNoZW1pc3RyeTwvYWJi

ci0xPjwvcGVyaW9kaWNhbD48cGFnZXM+MTQwNy0xNDEwPC9wYWdlcz48dm9sdW1lPjQyPC92b2x1

bWU+PGRhdGVzPjx5ZWFyPjE5OTQ8L3llYXI+PC9kYXRlcz48dXJscz48L3VybHM+PC9yZWNvcmQ+

PC9DaXRlPjxDaXRlPjxBdXRob3I+WmhvdTwvQXV0aG9yPjxZZWFyPjE5OTk8L1llYXI+PFJlY051

bT4xMTk8L1JlY051bT48cmVjb3JkPjxyZWMtbnVtYmVyPjExOTwvcmVjLW51bWJlcj48Zm9yZWln

bi1rZXlzPjxrZXkgYXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZlNnZhOXo1ZWV2Mmw1NWFhOHN4c2E1

OTllZXYycyI+MTE5PC9rZXk+PC9mb3JlaWduLWtleXM+PHJlZi10eXBlIG5hbWU9IkpvdXJuYWwg

QXJ0aWNsZSI+MTc8L3JlZi10eXBlPjxjb250cmlidXRvcnM+PGF1dGhvcnM+PGF1dGhvcj5aaG91

LCBTLjwvYXV0aG9yPjxhdXRob3I+RGVja2VyLCBFLiBBLjwvYXV0aG9yPjwvYXV0aG9ycz48L2Nv

bnRyaWJ1dG9ycz48YXV0aC1hZGRyZXNzPkRlcGFydG1lbnQgb2YgRm9vZCBTY2llbmNlLCBDaGVu

b3dldGggTGFib3JhdG9yeSwgVW5pdmVyc2l0eSBvZiBNYXNzYWNodXNldHRzLCBBbWhlcnN0LCBN

YXNzYWNodXNldHRzIDAxMDAzLCBVU0EuPC9hdXRoLWFkZHJlc3M+PHRpdGxlcz48dGl0bGU+QWJp

bGl0eSBvZiBjYXJub3NpbmUgYW5kIG90aGVyIHNrZWxldGFsIG11c2NsZSBjb21wb25lbnRzIHRv

IHF1ZW5jaCB1bnNhdHVyYXRlZCBhbGRlaHlkaWMgbGlwaWQgb3hpZGF0aW9uIHByb2R1Y3RzPC90

aXRsZT48c2Vjb25kYXJ5LXRpdGxlPkogQWdyaWMgRm9vZCBDaGVtPC9zZWNvbmRhcnktdGl0bGU+

PGFsdC10aXRsZT5Kb3VybmFsIG9mIGFncmljdWx0dXJhbCBhbmQgZm9vZCBjaGVtaXN0cnk8L2Fs

dC10aXRsZT48L3RpdGxlcz48cGVyaW9kaWNhbD48ZnVsbC10aXRsZT5KIEFncmljIEZvb2QgQ2hl

bTwvZnVsbC10aXRsZT48YWJici0xPkpvdXJuYWwgb2YgYWdyaWN1bHR1cmFsIGFuZCBmb29kIGNo

ZW1pc3RyeTwvYWJici0xPjwvcGVyaW9kaWNhbD48YWx0LXBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+

SiBBZ3JpYyBGb29kIENoZW08L2Z1bGwtdGl0bGU+PGFiYnItMT5Kb3VybmFsIG9mIGFncmljdWx0

dXJhbCBhbmQgZm9vZCBjaGVtaXN0cnk8L2FiYnItMT48L2FsdC1wZXJpb2RpY2FsPjxwYWdlcz41

MS01PC9wYWdlcz48dm9sdW1lPjQ3PC92b2x1bWU+PG51bWJlcj4xPC9udW1iZXI+PGVkaXRpb24+

MTk5OS8xMS8yNDwvZWRpdGlvbj48a2V5d29yZHM+PGtleXdvcmQ+QWxkZWh5ZGVzLyBtZXRhYm9s

aXNtPC9rZXl3b3JkPjxrZXl3b3JkPkNhcm5vc2luZS8gbWV0YWJvbGlzbTwva2V5d29yZD48a2V5

d29yZD5DaHJvbWF0b2dyYXBoeSwgR2FzPC9rZXl3b3JkPjxrZXl3b3JkPkNocm9tYXRvZ3JhcGh5

LCBIaWdoIFByZXNzdXJlIExpcXVpZDwva2V5d29yZD48a2V5d29yZD5MaXBpZCBQZXJveGlkYXRp

b248L2tleXdvcmQ+PGtleXdvcmQ+TXVzY2xlLCBTa2VsZXRhbC8gbWV0YWJvbGlzbTwva2V5d29y

ZD48L2tleXdvcmRzPjxkYXRlcz48eWVhcj4xOTk5PC95ZWFyPjxwdWItZGF0ZXM+PGRhdGU+SmFu

PC9kYXRlPjwvcHViLWRhdGVzPjwvZGF0ZXM+PGlzYm4+MDAyMS04NTYxIChQcmludCkmI3hEOzAw

MjEtODU2MSAoTGlua2luZyk8L2lzYm4+PGFjY2Vzc2lvbi1udW0+MTA1NjM4NDg8L2FjY2Vzc2lv

bi1udW0+PHVybHM+PC91cmxzPjxyZW1vdGUtZGF0YWJhc2UtcHJvdmlkZXI+TkxNPC9yZW1vdGUt

ZGF0YWJhc2UtcHJvdmlkZXI+PGxhbmd1YWdlPmVuZzwvbGFuZ3VhZ2U+PC9yZWNvcmQ+PC9DaXRl

PjwvRW5kTm90ZT4A

ADDIN EN.CITE PEVuZE5vdGU+PENpdGU+PEF1dGhvcj5EdXBpbjwvQXV0aG9yPjxZZWFyPjE5ODQ8L1llYXI+PFJl

Y051bT4xMTM8L1JlY051bT48RGlzcGxheVRleHQ+WzE1LTE5XTwvRGlzcGxheVRleHQ+PHJlY29y

ZD48cmVjLW51bWJlcj4xMTM8L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5IGFwcD0iRU4i

IGRiLWlkPSJ3MndmeGFmZTZ2YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjExMzwva2V5Pjwv

Zm9yZWlnbi1rZXlzPjxyZWYtdHlwZSBuYW1lPSJKb3VybmFsIEFydGljbGUiPjE3PC9yZWYtdHlw

ZT48Y29udHJpYnV0b3JzPjxhdXRob3JzPjxhdXRob3I+RHVwaW4sIEEuIE0uPC9hdXRob3I+PGF1

dGhvcj5Cb2xkeXJldiwgQS4gQS48L2F1dGhvcj48YXV0aG9yPkFya2hpcGVua28gSXUsIFYuPC9h

dXRob3I+PGF1dGhvcj5LYWdhbiwgVi4gRS48L2F1dGhvcj48L2F1dGhvcnM+PC9jb250cmlidXRv

cnM+PHRpdGxlcz48dGl0bGU+W0Nhcm5vc2luZSBwcm90ZWN0aW9uIG9mIENhMisgdHJhbnNwb3J0

IGFnYWluc3QgZGFtYWdlIGluZHVjZWQgYnkgbGlwaWQgcGVyb3hpZGF0aW9uXTwvdGl0bGU+PHNl

Y29uZGFyeS10aXRsZT5CaXVsbCBFa3NwIEJpb2wgTWVkPC9zZWNvbmRhcnktdGl0bGU+PGFsdC10

aXRsZT5CaXVsbGV0ZW4mYXBvczsgZWtzcGVyaW1lbnRhbCZhcG9zO25vaSBiaW9sb2dpaSBpIG1l

ZGl0c2lueTwvYWx0LXRpdGxlPjwvdGl0bGVzPjxwZXJpb2RpY2FsPjxmdWxsLXRpdGxlPkJpdWxs

IEVrc3AgQmlvbCBNZWQ8L2Z1bGwtdGl0bGU+PGFiYnItMT5CaXVsbGV0ZW4mYXBvczsgZWtzcGVy

aW1lbnRhbCZhcG9zO25vaSBiaW9sb2dpaSBpIG1lZGl0c2lueTwvYWJici0xPjwvcGVyaW9kaWNh

bD48YWx0LXBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+Qml1bGwgRWtzcCBCaW9sIE1lZDwvZnVsbC10

aXRsZT48YWJici0xPkJpdWxsZXRlbiZhcG9zOyBla3NwZXJpbWVudGFsJmFwb3M7bm9pIGJpb2xv

Z2lpIGkgbWVkaXRzaW55PC9hYmJyLTE+PC9hbHQtcGVyaW9kaWNhbD48cGFnZXM+MTg2LTg8L3Bh

Z2VzPjx2b2x1bWU+OTg8L3ZvbHVtZT48bnVtYmVyPjg8L251bWJlcj48ZWRpdGlvbj4xOTg0LzA4

LzAxPC9lZGl0aW9uPjxrZXl3b3Jkcz48a2V5d29yZD5BbmltYWxzPC9rZXl3b3JkPjxrZXl3b3Jk

PkJpb2xvZ2ljYWwgVHJhbnNwb3J0L2RydWcgZWZmZWN0czwva2V5d29yZD48a2V5d29yZD5DYWxj

aXVtLyBtZXRhYm9saXNtPC9rZXl3b3JkPjxrZXl3b3JkPkNhcm5vc2luZS8gcGhhcm1hY29sb2d5

PC9rZXl3b3JkPjxrZXl3b3JkPkRpcGVwdGlkZXMvIHBoYXJtYWNvbG9neTwva2V5d29yZD48a2V5

d29yZD5MaXBpZCBQZXJveGlkZXMvIG1ldGFib2xpc208L2tleXdvcmQ+PGtleXdvcmQ+TXVzY2xl

cy9kcnVnIGVmZmVjdHMvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5PeGlkYXRpb24tUmVk

dWN0aW9uL2RydWcgZWZmZWN0czwva2V5d29yZD48a2V5d29yZD5SYW5hIHRlbXBvcmFyaWE8L2tl

eXdvcmQ+PGtleXdvcmQ+U2FyY29wbGFzbWljIFJldGljdWx1bS9kcnVnIGVmZmVjdHMvbWV0YWJv

bGlzbTwva2V5d29yZD48L2tleXdvcmRzPjxkYXRlcz48eWVhcj4xOTg0PC95ZWFyPjxwdWItZGF0

ZXM+PGRhdGU+QXVnPC9kYXRlPjwvcHViLWRhdGVzPjwvZGF0ZXM+PG9yaWctcHViPlphc2hjaGl0

YSBrYXJub3ppbm9tIHRyYW5zcG9ydGEgQ2EyKyBvdCBwb3ZyZXpoZGVuaWksIHZ5enl2YWVteWto

IHBlcmVraXNueW0gb2tpc2xlbmllbSBsaXBpZG92Ljwvb3JpZy1wdWI+PGlzYm4+MDM2NS05NjE1

IChQcmludCkmI3hEOzAzNjUtOTYxNSAoTGlua2luZyk8L2lzYm4+PGFjY2Vzc2lvbi1udW0+NjMz

MTg2MjwvYWNjZXNzaW9uLW51bT48dXJscz48L3VybHM+PHJlbW90ZS1kYXRhYmFzZS1wcm92aWRl

cj5OTE08L3JlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj48bGFuZ3VhZ2U+cnVzPC9sYW5ndWFnZT48

L3JlY29yZD48L0NpdGU+PENpdGU+PEF1dGhvcj5Lb2hlbjwvQXV0aG9yPjxZZWFyPjE5ODg8L1ll

YXI+PFJlY051bT4xMDA8L1JlY051bT48cmVjb3JkPjxyZWMtbnVtYmVyPjEwMDwvcmVjLW51bWJl

cj48Zm9yZWlnbi1rZXlzPjxrZXkgYXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZlNnZhOXo1ZWV2Mmw1

NWFhOHN4c2E1OTllZXYycyI+MTAwPC9rZXk+PC9mb3JlaWduLWtleXM+PHJlZi10eXBlIG5hbWU9

IkpvdXJuYWwgQXJ0aWNsZSI+MTc8L3JlZi10eXBlPjxjb250cmlidXRvcnM+PGF1dGhvcnM+PGF1

dGhvcj5Lb2hlbiwgUi48L2F1dGhvcj48YXV0aG9yPllhbWFtb3RvLCBZLjwvYXV0aG9yPjxhdXRo

b3I+Q3VuZHksIEsuIEMuPC9hdXRob3I+PGF1dGhvcj5BbWVzLCBCLiBOLjwvYXV0aG9yPjwvYXV0

aG9ycz48L2NvbnRyaWJ1dG9ycz48YXV0aC1hZGRyZXNzPkRlcGFydG1lbnQgb2YgQmlvY2hlbWlz

dHJ5LCBVbml2ZXJzaXR5IG9mIENhbGlmb3JuaWEsIEJlcmtlbGV5IDk0NzIwLjwvYXV0aC1hZGRy

ZXNzPjx0aXRsZXM+PHRpdGxlPkFudGlveGlkYW50IGFjdGl2aXR5IG9mIGNhcm5vc2luZSwgaG9t

b2Nhcm5vc2luZSwgYW5kIGFuc2VyaW5lIHByZXNlbnQgaW4gbXVzY2xlIGFuZCBicmFpbjwvdGl0

bGU+PHNlY29uZGFyeS10aXRsZT5Qcm9jIE5hdGwgQWNhZCBTY2kgVSBTIEE8L3NlY29uZGFyeS10

aXRsZT48YWx0LXRpdGxlPlByb2NlZWRpbmdzIG9mIHRoZSBOYXRpb25hbCBBY2FkZW15IG9mIFNj

aWVuY2VzIG9mIHRoZSBVbml0ZWQgU3RhdGVzIG9mIEFtZXJpY2E8L2FsdC10aXRsZT48L3RpdGxl

cz48cGVyaW9kaWNhbD48ZnVsbC10aXRsZT5Qcm9jIE5hdGwgQWNhZCBTY2kgVSBTIEE8L2Z1bGwt

dGl0bGU+PGFiYnItMT5Qcm9jZWVkaW5ncyBvZiB0aGUgTmF0aW9uYWwgQWNhZGVteSBvZiBTY2ll

bmNlcyBvZiB0aGUgVW5pdGVkIFN0YXRlcyBvZiBBbWVyaWNhPC9hYmJyLTE+PC9wZXJpb2RpY2Fs

PjxhbHQtcGVyaW9kaWNhbD48ZnVsbC10aXRsZT5Qcm9jIE5hdGwgQWNhZCBTY2kgVSBTIEE8L2Z1

bGwtdGl0bGU+PGFiYnItMT5Qcm9jZWVkaW5ncyBvZiB0aGUgTmF0aW9uYWwgQWNhZGVteSBvZiBT

Y2llbmNlcyBvZiB0aGUgVW5pdGVkIFN0YXRlcyBvZiBBbWVyaWNhPC9hYmJyLTE+PC9hbHQtcGVy

aW9kaWNhbD48cGFnZXM+MzE3NS05PC9wYWdlcz48dm9sdW1lPjg1PC92b2x1bWU+PG51bWJlcj45

PC9udW1iZXI+PGVkaXRpb24+MTk4OC8wNS8wMTwvZWRpdGlvbj48a2V5d29yZHM+PGtleXdvcmQ+

QW1pZGluZXMvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5BbnNlcmluZS8gcGhhcm1hY29s

b2d5PC9rZXl3b3JkPjxrZXl3b3JkPkFudGlveGlkYW50cy8gcGhhcm1hY29sb2d5PC9rZXl3b3Jk

PjxrZXl3b3JkPkF6byBDb21wb3VuZHMvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5CcmFp

bi8gbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5DYXJub3NpbmUvYW5hbG9ncyAmYW1wOyBk

ZXJpdmF0aXZlcy8gcGhhcm1hY29sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPkNocm9tYXRvZ3JhcGh5

LCBIaWdoIFByZXNzdXJlIExpcXVpZDwva2V5d29yZD48a2V5d29yZD5EZW94eWd1YW5vc2luZS9t

ZXRhYm9saXNtPC9rZXl3b3JkPjxrZXl3b3JkPkRpcGVwdGlkZXMvIHBoYXJtYWNvbG9neTwva2V5

d29yZD48a2V5d29yZD5FbGVjdHJvY2hlbWlzdHJ5PC9rZXl3b3JkPjxrZXl3b3JkPkZyZWUgUmFk

aWNhbHM8L2tleXdvcmQ+PGtleXdvcmQ+SGlzdGlkaW5lL2FuYWxvZ3MgJmFtcDsgZGVyaXZhdGl2

ZXMvcGhhcm1hY29sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPkxpcGlkIFBlcm94aWRlcy9tZXRhYm9s

aXNtPC9rZXl3b3JkPjxrZXl3b3JkPk11c2NsZXMvIG1ldGFib2xpc208L2tleXdvcmQ+PGtleXdv

cmQ+Tml0cmlsZXMvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5Tb2x1dGlvbnM8L2tleXdv

cmQ+PGtleXdvcmQ+U3RydWN0dXJlLUFjdGl2aXR5IFJlbGF0aW9uc2hpcDwva2V5d29yZD48L2tl

eXdvcmRzPjxkYXRlcz48eWVhcj4xOTg4PC95ZWFyPjxwdWItZGF0ZXM+PGRhdGU+TWF5PC9kYXRl

PjwvcHViLWRhdGVzPjwvZGF0ZXM+PGlzYm4+MDAyNy04NDI0IChQcmludCkmI3hEOzAwMjctODQy

NCAoTGlua2luZyk8L2lzYm4+PGFjY2Vzc2lvbi1udW0+MzM2Mjg2NjwvYWNjZXNzaW9uLW51bT48

dXJscz48L3VybHM+PGN1c3RvbTI+UE1DMjgwMTY2PC9jdXN0b20yPjxyZW1vdGUtZGF0YWJhc2Ut

cHJvdmlkZXI+TkxNPC9yZW1vdGUtZGF0YWJhc2UtcHJvdmlkZXI+PGxhbmd1YWdlPmVuZzwvbGFu

Z3VhZ2U+PC9yZWNvcmQ+PC9DaXRlPjxDaXRlPjxBdXRob3I+S2xlYmFub3Y8L0F1dGhvcj48WWVh

cj4xOTk3PC9ZZWFyPjxSZWNOdW0+MTQ0PC9SZWNOdW0+PHJlY29yZD48cmVjLW51bWJlcj4xNDQ8

L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5IGFwcD0iRU4iIGRiLWlkPSJ3MndmeGFmZTZ2

YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjE0NDwva2V5PjwvZm9yZWlnbi1rZXlzPjxyZWYt

dHlwZSBuYW1lPSJKb3VybmFsIEFydGljbGUiPjE3PC9yZWYtdHlwZT48Y29udHJpYnV0b3JzPjxh

dXRob3JzPjxhdXRob3I+S2xlYmFub3YsIEcuIEkuPC9hdXRob3I+PGF1dGhvcj5UZXNlbGtpbiBZ

dSwgTy48L2F1dGhvcj48YXV0aG9yPkJhYmVua292YSwgSS4gVi48L2F1dGhvcj48YXV0aG9yPlBv

cG92LCBJLiBOLjwvYXV0aG9yPjxhdXRob3I+TGV2aW4sIEcuPC9hdXRob3I+PGF1dGhvcj5UeXVs

aW5hLCBPLiBWLjwvYXV0aG9yPjxhdXRob3I+Qm9sZHlyZXYsIEEuIEEuPC9hdXRob3I+PGF1dGhv

cj5WbGFkaW1pcm92IFl1LCBBLjwvYXV0aG9yPjwvYXV0aG9ycz48L2NvbnRyaWJ1dG9ycz48YXV0

aC1hZGRyZXNzPlJ1c3NpYW4gU3RhdGUgTWVkaWNhbCBVbml2ZXJzaXR5LCBNb3Njb3csIFJ1c3Np

YS48L2F1dGgtYWRkcmVzcz48dGl0bGVzPjx0aXRsZT5FdmlkZW5jZSBmb3IgYSBkaXJlY3QgaW50

ZXJhY3Rpb24gb2Ygc3VwZXJveGlkZSBhbmlvbiByYWRpY2FsIHdpdGggY2Fybm9zaW5lPC90aXRs

ZT48c2Vjb25kYXJ5LXRpdGxlPkJpb2NoZW0gTW9sIEJpb2wgSW50PC9zZWNvbmRhcnktdGl0bGU+

PGFsdC10aXRsZT5CaW9jaGVtaXN0cnkgYW5kIG1vbGVjdWxhciBiaW9sb2d5IGludGVybmF0aW9u

YWw8L2FsdC10aXRsZT48L3RpdGxlcz48cGVyaW9kaWNhbD48ZnVsbC10aXRsZT5CaW9jaGVtIE1v

bCBCaW9sIEludDwvZnVsbC10aXRsZT48YWJici0xPkJpb2NoZW1pc3RyeSBhbmQgbW9sZWN1bGFy

IGJpb2xvZ3kgaW50ZXJuYXRpb25hbDwvYWJici0xPjwvcGVyaW9kaWNhbD48YWx0LXBlcmlvZGlj

YWw+PGZ1bGwtdGl0bGU+QmlvY2hlbSBNb2wgQmlvbCBJbnQ8L2Z1bGwtdGl0bGU+PGFiYnItMT5C

aW9jaGVtaXN0cnkgYW5kIG1vbGVjdWxhciBiaW9sb2d5IGludGVybmF0aW9uYWw8L2FiYnItMT48

L2FsdC1wZXJpb2RpY2FsPjxwYWdlcz45OS0xMDY8L3BhZ2VzPjx2b2x1bWU+NDM8L3ZvbHVtZT48

bnVtYmVyPjE8L251bWJlcj48ZWRpdGlvbj4xOTk3LzEwLzA3PC9lZGl0aW9uPjxrZXl3b3Jkcz48

a2V5d29yZD5DYXJub3NpbmUvIG1ldGFib2xpc20vcGhhcm1hY29sb2d5PC9rZXl3b3JkPjxrZXl3

b3JkPkx1bWluZXNjZW50IE1lYXN1cmVtZW50czwva2V5d29yZD48a2V5d29yZD5MdW1pbm9sL21l

dGFib2xpc208L2tleXdvcmQ+PGtleXdvcmQ+Tml0cm9ibHVlIFRldHJhem9saXVtL21ldGFib2xp

c208L2tleXdvcmQ+PGtleXdvcmQ+T3hpZGF0aW9uLVJlZHVjdGlvbjwva2V5d29yZD48a2V5d29y

ZD5TdXBlcm94aWRlcy8gbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5YYW50aGluZSBPeGlk

YXNlL21ldGFib2xpc208L2tleXdvcmQ+PC9rZXl3b3Jkcz48ZGF0ZXM+PHllYXI+MTk5NzwveWVh

cj48cHViLWRhdGVzPjxkYXRlPlNlcDwvZGF0ZT48L3B1Yi1kYXRlcz48L2RhdGVzPjxpc2JuPjEw

MzktOTcxMiAoUHJpbnQpJiN4RDsxMDM5LTk3MTIgKExpbmtpbmcpPC9pc2JuPjxhY2Nlc3Npb24t

bnVtPjkzMTUyODc8L2FjY2Vzc2lvbi1udW0+PHVybHM+PC91cmxzPjxyZW1vdGUtZGF0YWJhc2Ut

cHJvdmlkZXI+TkxNPC9yZW1vdGUtZGF0YWJhc2UtcHJvdmlkZXI+PGxhbmd1YWdlPmVuZzwvbGFu

Z3VhZ2U+PC9yZWNvcmQ+PC9DaXRlPjxDaXRlPjxBdXRob3I+Q2hhbjwvQXV0aG9yPjxZZWFyPjE5

OTQ8L1llYXI+PFJlY051bT4xNDU8L1JlY051bT48cmVjb3JkPjxyZWMtbnVtYmVyPjE0NTwvcmVj

LW51bWJlcj48Zm9yZWlnbi1rZXlzPjxrZXkgYXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZlNnZhOXo1

ZWV2Mmw1NWFhOHN4c2E1OTllZXYycyI+MTQ1PC9rZXk+PC9mb3JlaWduLWtleXM+PHJlZi10eXBl

IG5hbWU9IkpvdXJuYWwgQXJ0aWNsZSI+MTc8L3JlZi10eXBlPjxjb250cmlidXRvcnM+PGF1dGhv

cnM+PGF1dGhvcj5DaGFuLCBXLiBLLiBNLiwgPC9hdXRob3I+PGF1dGhvcj5EZWNrZXIsIEUuIEEu

LCA8L2F1dGhvcj48YXV0aG9yPkxlZSwgSi4gQi4sIDwvYXV0aG9yPjxhdXRob3I+QnV0dGVyZmll

bGQsIEQuIEEuIDwvYXV0aG9yPjwvYXV0aG9ycz48L2NvbnRyaWJ1dG9ycz48dGl0bGVzPjx0aXRs

ZT5FUFIgc3Bpbi10cmFwcGluZyBzdHVkaWVzIG9mIHRoZSBoeWRyb3h5bCByYWRpY2FsIHNjYXZl

bmdpbmcgYWN0aXZpdHkgb2YgY2Fybm9zaW5lIGFuZCByZWxhdGVkIGRpcGVwdGlkZXM8L3RpdGxl

PjxzZWNvbmRhcnktdGl0bGU+SiBBZ3JpYyBGb29kIENoZW08L3NlY29uZGFyeS10aXRsZT48L3Rp

dGxlcz48cGVyaW9kaWNhbD48ZnVsbC10aXRsZT5KIEFncmljIEZvb2QgQ2hlbTwvZnVsbC10aXRs

ZT48YWJici0xPkpvdXJuYWwgb2YgYWdyaWN1bHR1cmFsIGFuZCBmb29kIGNoZW1pc3RyeTwvYWJi

ci0xPjwvcGVyaW9kaWNhbD48cGFnZXM+MTQwNy0xNDEwPC9wYWdlcz48dm9sdW1lPjQyPC92b2x1

bWU+PGRhdGVzPjx5ZWFyPjE5OTQ8L3llYXI+PC9kYXRlcz48dXJscz48L3VybHM+PC9yZWNvcmQ+

PC9DaXRlPjxDaXRlPjxBdXRob3I+WmhvdTwvQXV0aG9yPjxZZWFyPjE5OTk8L1llYXI+PFJlY051

bT4xMTk8L1JlY051bT48cmVjb3JkPjxyZWMtbnVtYmVyPjExOTwvcmVjLW51bWJlcj48Zm9yZWln

bi1rZXlzPjxrZXkgYXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZlNnZhOXo1ZWV2Mmw1NWFhOHN4c2E1

OTllZXYycyI+MTE5PC9rZXk+PC9mb3JlaWduLWtleXM+PHJlZi10eXBlIG5hbWU9IkpvdXJuYWwg

QXJ0aWNsZSI+MTc8L3JlZi10eXBlPjxjb250cmlidXRvcnM+PGF1dGhvcnM+PGF1dGhvcj5aaG91

LCBTLjwvYXV0aG9yPjxhdXRob3I+RGVja2VyLCBFLiBBLjwvYXV0aG9yPjwvYXV0aG9ycz48L2Nv

bnRyaWJ1dG9ycz48YXV0aC1hZGRyZXNzPkRlcGFydG1lbnQgb2YgRm9vZCBTY2llbmNlLCBDaGVu

b3dldGggTGFib3JhdG9yeSwgVW5pdmVyc2l0eSBvZiBNYXNzYWNodXNldHRzLCBBbWhlcnN0LCBN

YXNzYWNodXNldHRzIDAxMDAzLCBVU0EuPC9hdXRoLWFkZHJlc3M+PHRpdGxlcz48dGl0bGU+QWJp

bGl0eSBvZiBjYXJub3NpbmUgYW5kIG90aGVyIHNrZWxldGFsIG11c2NsZSBjb21wb25lbnRzIHRv

IHF1ZW5jaCB1bnNhdHVyYXRlZCBhbGRlaHlkaWMgbGlwaWQgb3hpZGF0aW9uIHByb2R1Y3RzPC90

aXRsZT48c2Vjb25kYXJ5LXRpdGxlPkogQWdyaWMgRm9vZCBDaGVtPC9zZWNvbmRhcnktdGl0bGU+

PGFsdC10aXRsZT5Kb3VybmFsIG9mIGFncmljdWx0dXJhbCBhbmQgZm9vZCBjaGVtaXN0cnk8L2Fs

dC10aXRsZT48L3RpdGxlcz48cGVyaW9kaWNhbD48ZnVsbC10aXRsZT5KIEFncmljIEZvb2QgQ2hl

bTwvZnVsbC10aXRsZT48YWJici0xPkpvdXJuYWwgb2YgYWdyaWN1bHR1cmFsIGFuZCBmb29kIGNo

ZW1pc3RyeTwvYWJici0xPjwvcGVyaW9kaWNhbD48YWx0LXBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+

SiBBZ3JpYyBGb29kIENoZW08L2Z1bGwtdGl0bGU+PGFiYnItMT5Kb3VybmFsIG9mIGFncmljdWx0

dXJhbCBhbmQgZm9vZCBjaGVtaXN0cnk8L2FiYnItMT48L2FsdC1wZXJpb2RpY2FsPjxwYWdlcz41

MS01PC9wYWdlcz48dm9sdW1lPjQ3PC92b2x1bWU+PG51bWJlcj4xPC9udW1iZXI+PGVkaXRpb24+

MTk5OS8xMS8yNDwvZWRpdGlvbj48a2V5d29yZHM+PGtleXdvcmQ+QWxkZWh5ZGVzLyBtZXRhYm9s

aXNtPC9rZXl3b3JkPjxrZXl3b3JkPkNhcm5vc2luZS8gbWV0YWJvbGlzbTwva2V5d29yZD48a2V5

d29yZD5DaHJvbWF0b2dyYXBoeSwgR2FzPC9rZXl3b3JkPjxrZXl3b3JkPkNocm9tYXRvZ3JhcGh5

LCBIaWdoIFByZXNzdXJlIExpcXVpZDwva2V5d29yZD48a2V5d29yZD5MaXBpZCBQZXJveGlkYXRp

b248L2tleXdvcmQ+PGtleXdvcmQ+TXVzY2xlLCBTa2VsZXRhbC8gbWV0YWJvbGlzbTwva2V5d29y

ZD48L2tleXdvcmRzPjxkYXRlcz48eWVhcj4xOTk5PC95ZWFyPjxwdWItZGF0ZXM+PGRhdGU+SmFu

PC9kYXRlPjwvcHViLWRhdGVzPjwvZGF0ZXM+PGlzYm4+MDAyMS04NTYxIChQcmludCkmI3hEOzAw

MjEtODU2MSAoTGlua2luZyk8L2lzYm4+PGFjY2Vzc2lvbi1udW0+MTA1NjM4NDg8L2FjY2Vzc2lv

bi1udW0+PHVybHM+PC91cmxzPjxyZW1vdGUtZGF0YWJhc2UtcHJvdmlkZXI+TkxNPC9yZW1vdGUt

ZGF0YWJhc2UtcHJvdmlkZXI+PGxhbmd1YWdlPmVuZzwvbGFuZ3VhZ2U+PC9yZWNvcmQ+PC9DaXRl

PjwvRW5kTm90ZT4A

ADDIN EN.CITE.DATA [15-19] можно предположить, что замедление клеточной пролиферации под действием карнозина является результатом его антиоксидантного эффекта. Для того чтобы выяснить, сопровождается ли снижение количества клеток РС-12 под действием карнозина изменениями уровня АФК, клетки РС-12 обрабатывали карнозином (50 мМ) в течение 0,5 - 48 ч. Уровень АФК измеряли на проточном цитометре по степени окисления флуоресцентного красителя DCFH2-DA, результаты измерения представлены на Рис. 3.1.2. Как следует из Рис. 3.1.2, уже через 30 мин инкубации уровень АФК в пробах с карнозином снижался на 50% по сравнению с контролем. Пониженный уровень АФК поддерживался на протяжении 24 ч и возвращался к контрольному уровню через 48 ч. Поскольку снижение уровня АФК по времени предшествовало снижению количества клеток (Рис. 3.1.1.Б), можно предположить, что индуцированное карнозином замедление пролиферации клеток РС-12 является результатом его антиоксидантного эффекта.

3.1.3. Карнозин и его производные индуцируют накопление клеток РС-12 в S и G2/М фазах клеточного циклаПролиферация - это процесс увеличения количества клеток путем деления. Период времени от образования новой клетки до ее деления на две называется клеточным циклом. Клеточный цикл представляет собой совокупность последовательных строго организованных переходов от G1 фазы к S, к G2 и М (митоз). Нарушение прогрессии клеточного цикла ведет к его остановке (блоку) и препятствует дальнейшей пролиферации ADDIN EN.CITE <EndNote><Cite><Author>Grana</Author><Year>1995</Year><RecNum>259</RecNum><DisplayText>[81]</DisplayText><record><rec-number>259</rec-number><foreign-keys><key app="EN" db-id="w2wfxafe6va9z5eev2l55aa8sxsa599eev2s">259</key></foreign-keys><ref-type name="Journal Article">17</ref-type><contributors><authors><author>Grana, X.

</author><author>Reddy, E. P.</author></authors></contributors><auth-address>Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, Philadelphia, PA 19140, USA.</auth-address><titles><title>Cell cycle control in mammalian cells: role of cyclins, cyclin dependent kinases (CDKs), growth suppressor genes and cyclin-dependent kinase inhibitors (CKIs)</title><secondary-title>Oncogene</secondary-title><alt-title>Oncogene</alt-title></titles><periodical><full-title>Oncogene</full-title><abbr-1>Oncogene</abbr-1></periodical><alt-periodical><full-title>Oncogene</full-title><abbr-1>Oncogene</abbr-1></alt-periodical><pages>211-9</pages><volume>11</volume><number>2</number><edition>1995/07/20</edition><keywords><keyword>Animals</keyword><keyword>Cell Cycle/ physiology</keyword><keyword>Cyclin-Dependent Kinases/ antagonists &amp; inhibitors/ physiology</keyword><keyword>Cyclins/ physiology</keyword><keyword>Enzyme Inhibitors/ pharmacology</keyword><keyword>Genes, Tumor Suppressor</keyword><keyword>Humans</keyword></keywords><dates><year>1995</year><pub-dates><date>Jul 20</date></pub-dates></dates><isbn>0950-9232 (Print)&#xD;0950-9232 (Linking)</isbn><accession-num>7624138</accession-num><urls></urls><remote-database-provider>NLM</remote-database-provider><language>eng</language></record></Cite></EndNote>[81]. Для того чтобы выяснить, связано ли индуцируемое карнозином снижение количества клеток РС-12 с изменениями в прогрессии клеточного цикла, клетки РС-12 обрабатывали карнозином (10 - 50 мМ) в течение 48 ч. По истечении периода инкубации клетки фиксировали, окрашивали PI и с помощью проточного цитометра измеряли количество клеток в G0/G1, S и G2/М фазах по интенсивности флуоресценции PI. На Рис. 3.1.3.А. представлен пример распределения клеток по фазам клеточного цикла в контроле и после инкубации с 50 мМ карнозина. Результаты анализа процентного распределения клеток по фазам клеточного цикла представлены на Рис. 3.1.3.Б.

Рисунок 3.1.

3. Карнозин индуцирует накопление клеток РС-12 в S и G2/М-фазах клеточного цикла. Клетки инкубировали с карнозином (5 - 50 мМ) в течение 48 ч. Содержание ДНК измеряли на проточном цитометре по интенсивности флуоресценции PI. (А) Пример распределения клеток по фазам клеточного цикла в контроле и после инкубации с 50 мМ карнозина. (Б) Процентное распределение клеток по фазам клеточного цикла в контроле и после обработки карнозином. Звездочка обозначает статистически значимое отличие от количества клеток в контроле; n=3, p<0.05.

Как следует из Рис. 3.1.3.Б, карнозин дозо-зависимо увеличивал количество клеток в S и G2/M фазах клеточного цикла. Параллельно происходило снижение количества клеток в G0/G1 фазе. Достоверно отличимый от контроля результат был получен при концентрациях 25 - 50 мМ карнозина. В пробах, обработанных 50 мМ карнозина, число S и G2/M клеток возрастало, соответственно, до 15% и 22%, по сравнению с 12% и 17% в контроле. Количество G0/G1 клеток при этом снижалось до 62% по сравнению с 71% в контроле. Важно отметить, что увеличения количества апоптотических клеток под действием карнозина выявлено не было (отсутствует sub-G1 пик, Рис. 3.1.3.А). Это еще раз подтверждает способность карнозина воздействовать на процессы клеточной пролиферации, а не гибели. Исходя из полученных данных, был сделан вывод о том, что снижение количества клеток РС-12 под действием карнозина происходит в результате замедления прогрессии клеточного цикла и накопления клеток в S и G2/М фазах клеточного цикла.

У карнозина есть несколько природных производных, среди которых наиболее изученными являются ацетил-карнозин (N-ацетил--аланил-L-гистидин) и анзерин (у-амино-бутирил-L-гистидин). Изучение структурно-функциональных взаимосвязей между карнозином и его производными в отношении изменения прогрессии клеточного цикла клеток РС-12 может помочь оценить степень вовлеченности отдельных частей молекулы в исследуемый эффект карнозина. Для того чтобы сравнить, изменения в прогрессии клеточного цикла под действием карнозина и его производных, клетки обрабатывали 50 мМ карнозина, анзерина или ацетил-карнозина в течение 48 ч и анализировали распределение клеток по фазам клеточного цикла согласно содержанию ДНК (Рис. 3.1.4). Как видно из Рис. 3.1.4.А, все исследованные вещества индуцировали накопление клеток в S и G2/М фазах, однако наиболее выраженный эффект демонстрировал анзерин. В пробах обработанных анзерином количество S и G2/М клеток возрастало, соответственно, на 79% и 65%. А количество G0/G1 клеток уменьшалось на 21%. Наименее выраженный эффект демонстрировал ацетил-карнозин. Основываясь на полученных данных, было сделано заключение о том, что метилирование карнозина способствует усилению ингибирующего эффекта на прогрессию клеточного цикла, в то время как ацетилирование карнозина этот эффект ослабляет.

Рисунок 3.1.

4. Анзерин и L-гистидин--аланин замедляют прогрессию клеточного цикла эффективнее, чем карнозин. Клетки РС-12 инкубировали с карнозином и его производными в течение 48 ч. Содержание ДНК измеряли на проточном цитометре по интенсивности флуоресценции PI. Процентное распределение клеток по фазам клеточного цикла в контроле и после инкубации с 50 мМ карнозина, анзерина, ацетил-карнозина (А) или 1 - 10 мМ L-гистидин--аланина (Б). Звездочка обозначает статистически значимое отличие от количества клеток в контроле; n=3, p<0.05.

Синтетическое производное карнозина L-гистидин--аланин, представляющий собой последовательность аминокислот карнозина в обратном порядке (т.н. «Карнозин наоборот») эффективнее, чем карнозин индуцировал накопление клеток в S и G2/М фазах клеточного цикла (Рис. 3.1.4.Б). Клетки обрабатывали L-гистидин--аланином в концентрации 1 - 10 мМ в течении 48 ч, затем с помощью проточного цитометра изучали распределение клеток по фазам клеточного цикла согласно содержанию ДНК. Достоверно отличимый от контроля результат наблюдали при концентрации 5 – 10 мМ, то есть в 5 раз ниже, чем для карнозина. Причем, под действием 10 мМ L-гистидин--аланина количество S и G2/М клеток возрастало на 80% и 60% соответственно, что превышало значения, полученные под действием 50 мМ карнозина. В концентрации выше 10 мМ L-гистидин--аланин проявлял токсическое действие, поскольку приводил к гибели более 90% клеток. Таким образом, L-гистидин--аланин замедлял прогрессию клеточного цикла эффективнее, чем карнозин, однако обладал сильным цитотоксическим эффектом.

3.1.4. Изучение воздействия синтетического трипептида пинеалона на клеточный циклПинеалон представляет собой синтетический трипептид (Glu-Asp-Arg), синтезированный на основе анализа экстракта коры головного мозга крупного рогатого скота и проявляющий эффективные антиоксидантные свойства PEVuZE5vdGU+PENpdGU+PEF1dGhvcj5Lb3ppbmE8L0F1dGhvcj48WWVhcj4yMDA4PC9ZZWFyPjxS

ZWNOdW0+Mjk3PC9SZWNOdW0+PERpc3BsYXlUZXh0PlsyNDQtMjQ2XTwvRGlzcGxheVRleHQ+PHJl

Y29yZD48cmVjLW51bWJlcj4yOTc8L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5IGFwcD0i

RU4iIGRiLWlkPSJ3MndmeGFmZTZ2YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjI5Nzwva2V5

PjwvZm9yZWlnbi1rZXlzPjxyZWYtdHlwZSBuYW1lPSJKb3VybmFsIEFydGljbGUiPjE3PC9yZWYt

dHlwZT48Y29udHJpYnV0b3JzPjxhdXRob3JzPjxhdXRob3I+S296aW5hLCBMLiBTLjwvYXV0aG9y

PjwvYXV0aG9ycz48L2NvbnRyaWJ1dG9ycz48dGl0bGVzPjx0aXRsZT5bSW52ZXN0aWdhdGlvbiBv

ZiBhbnRpaHlwb3hpYyBwcm9wZXJ0aWVzIG9mIHNob3J0IHBlcHRpZGVzXTwvdGl0bGU+PHNlY29u

ZGFyeS10aXRsZT5BZHYgR2Vyb250b2w8L3NlY29uZGFyeS10aXRsZT48YWx0LXRpdGxlPkFkdmFu

Y2VzIGluIGdlcm9udG9sb2d5ID0gVXNwZWtoaSBnZXJvbnRvbG9naWkgLyBSb3NzaWlza2FpYSBh

a2FkZW1paWEgbmF1aywgR2Vyb250b2xvZ2ljaGVza29lIG9ic2hjaGVzdHZvPC9hbHQtdGl0bGU+

PC90aXRsZXM+PHBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+QWR2IEdlcm9udG9sPC9mdWxsLXRpdGxl

PjxhYmJyLTE+QWR2YW5jZXMgaW4gZ2Vyb250b2xvZ3kgPSBVc3Bla2hpIGdlcm9udG9sb2dpaSAv

IFJvc3NpaXNrYWlhIGFrYWRlbWlpYSBuYXVrLCBHZXJvbnRvbG9naWNoZXNrb2Ugb2JzaGNoZXN0

dm88L2FiYnItMT48L3BlcmlvZGljYWw+PGFsdC1wZXJpb2RpY2FsPjxmdWxsLXRpdGxlPkFkdiBH

ZXJvbnRvbDwvZnVsbC10aXRsZT48YWJici0xPkFkdmFuY2VzIGluIGdlcm9udG9sb2d5ID0gVXNw

ZWtoaSBnZXJvbnRvbG9naWkgLyBSb3NzaWlza2FpYSBha2FkZW1paWEgbmF1aywgR2Vyb250b2xv

Z2ljaGVza29lIG9ic2hjaGVzdHZvPC9hYmJyLTE+PC9hbHQtcGVyaW9kaWNhbD48cGFnZXM+NjEt

NzwvcGFnZXM+PHZvbHVtZT4yMTwvdm9sdW1lPjxudW1iZXI+MTwvbnVtYmVyPjxlZGl0aW9uPjIw

MDgvMDYvMTM8L2VkaXRpb24+PGtleXdvcmRzPjxrZXl3b3JkPkFkYXB0YXRpb24sIFBoeXNpb2xv

Z2ljYWwvZHJ1ZyBlZmZlY3RzPC9rZXl3b3JkPjxrZXl3b3JkPkFkZW5vc2luZSBUcmlwaG9zcGhh

dGUvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5BbmltYWxzPC9rZXl3b3JkPjxrZXl3b3Jk

PkFub3hpYS9jb21wbGljYXRpb25zL3BoeXNpb3BhdGhvbG9neS9wcmV2ZW50aW9uICZhbXA7IGNv

bnRyb2w8L2tleXdvcmQ+PGtleXdvcmQ+QmVoYXZpb3IsIEFuaW1hbC9kcnVnIGVmZmVjdHM8L2tl

eXdvcmQ+PGtleXdvcmQ+QnJhaW4vIGRydWcgZWZmZWN0cy9lbnp5bW9sb2d5L2dyb3d0aCAmYW1w

OyBkZXZlbG9wbWVudC9wYXRob2xvZ3k8L2tleXdvcmQ+PGtleXdvcmQ+RmVtYWxlPC9rZXl3b3Jk

PjxrZXl3b3JkPkdsdXRhdGhpb25lIFBlcm94aWRhc2UvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5

d29yZD5MaXZlci9kcnVnIGVmZmVjdHMvZW56eW1vbG9neS9ncm93dGggJmFtcDsgZGV2ZWxvcG1l

bnQvcGF0aG9sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPk1hbGU8L2tleXdvcmQ+PGtleXdvcmQ+TmV1

cm9wcm90ZWN0aXZlIEFnZW50cy9jaGVtaXN0cnkvcGhhcm1hY29sb2d5LyB0aGVyYXBldXRpYyB1

c2U8L2tleXdvcmQ+PGtleXdvcmQ+T2xpZ29wZXB0aWRlcy9jaGVtaXN0cnkvcGhhcm1hY29sb2d5

LyB0aGVyYXBldXRpYyB1c2U8L2tleXdvcmQ+PGtleXdvcmQ+T3hpZGF0aXZlIFN0cmVzcy9kcnVn

IGVmZmVjdHM8L2tleXdvcmQ+PGtleXdvcmQ+UHJlZ25hbmN5PC9rZXl3b3JkPjxrZXl3b3JkPlBy

ZW5hdGFsIEV4cG9zdXJlIERlbGF5ZWQgRWZmZWN0cy9ldGlvbG9neS9waHlzaW9wYXRob2xvZ3kv

cHJldmVudGlvbiAmYW1wOyBjb250cm9sPC9rZXl3b3JkPjxrZXl3b3JkPlJhdHM8L2tleXdvcmQ+

PGtleXdvcmQ+UmF0cywgV2lzdGFyPC9rZXl3b3JkPjxrZXl3b3JkPlJlc3BpcmF0b3J5IFBoeXNp

b2xvZ2ljYWwgUGhlbm9tZW5hL2RydWcgZWZmZWN0czwva2V5d29yZD48a2V5d29yZD5TdXBlcm94

aWRlIERpc211dGFzZS9tZXRhYm9saXNtPC9rZXl3b3JkPjwva2V5d29yZHM+PGRhdGVzPjx5ZWFy

PjIwMDg8L3llYXI+PC9kYXRlcz48aXNibj4xNTYxLTkxMjUgKFByaW50KSYjeEQ7MTU2MS05MTI1

IChMaW5raW5nKTwvaXNibj48YWNjZXNzaW9uLW51bT4xODU0NjgyNTwvYWNjZXNzaW9uLW51bT48

dXJscz48L3VybHM+PHJlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj5OTE08L3JlbW90ZS1kYXRhYmFz

ZS1wcm92aWRlcj48bGFuZ3VhZ2U+cnVzPC9sYW5ndWFnZT48L3JlY29yZD48L0NpdGU+PENpdGU+

PEF1dGhvcj5Lb3ppbmE8L0F1dGhvcj48WWVhcj4yMDA4PC9ZZWFyPjxSZWNOdW0+Mjk2PC9SZWNO

dW0+PHJlY29yZD48cmVjLW51bWJlcj4yOTY8L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5

IGFwcD0iRU4iIGRiLWlkPSJ3MndmeGFmZTZ2YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjI5

Njwva2V5PjwvZm9yZWlnbi1rZXlzPjxyZWYtdHlwZSBuYW1lPSJKb3VybmFsIEFydGljbGUiPjE3

PC9yZWYtdHlwZT48Y29udHJpYnV0b3JzPjxhdXRob3JzPjxhdXRob3I+S296aW5hLCBMLiBTLjwv

YXV0aG9yPjxhdXRob3I+QXJ1dGl1bmlhbiwgQS4gVi48L2F1dGhvcj48YXV0aG9yPlN0dm9saW5z

a2lpLCBTLiBMLjwvYXV0aG9yPjxhdXRob3I+S2hhdmluc29uLCBWS2g8L2F1dGhvcj48L2F1dGhv

cnM+PC9jb250cmlidXRvcnM+PHRpdGxlcz48dGl0bGU+W0Jpb2xvZ2ljYWwgYWN0aXZpdHkgb2Yg

cmVndWxhdG9yeSBwZXB0aWRlcyBpbiBtb2RlbCBleHBlcmltZW50cyBpbiB2aXRyb108L3RpdGxl

PjxzZWNvbmRhcnktdGl0bGU+QWR2IEdlcm9udG9sPC9zZWNvbmRhcnktdGl0bGU+PGFsdC10aXRs

ZT5BZHZhbmNlcyBpbiBnZXJvbnRvbG9neSA9IFVzcGVraGkgZ2Vyb250b2xvZ2lpIC8gUm9zc2lp

c2thaWEgYWthZGVtaWlhIG5hdWssIEdlcm9udG9sb2dpY2hlc2tvZSBvYnNoY2hlc3R2bzwvYWx0

LXRpdGxlPjwvdGl0bGVzPjxwZXJpb2RpY2FsPjxmdWxsLXRpdGxlPkFkdiBHZXJvbnRvbDwvZnVs

bC10aXRsZT48YWJici0xPkFkdmFuY2VzIGluIGdlcm9udG9sb2d5ID0gVXNwZWtoaSBnZXJvbnRv

bG9naWkgLyBSb3NzaWlza2FpYSBha2FkZW1paWEgbmF1aywgR2Vyb250b2xvZ2ljaGVza29lIG9i

c2hjaGVzdHZvPC9hYmJyLTE+PC9wZXJpb2RpY2FsPjxhbHQtcGVyaW9kaWNhbD48ZnVsbC10aXRs

ZT5BZHYgR2Vyb250b2w8L2Z1bGwtdGl0bGU+PGFiYnItMT5BZHZhbmNlcyBpbiBnZXJvbnRvbG9n

eSA9IFVzcGVraGkgZ2Vyb250b2xvZ2lpIC8gUm9zc2lpc2thaWEgYWthZGVtaWlhIG5hdWssIEdl

cm9udG9sb2dpY2hlc2tvZSBvYnNoY2hlc3R2bzwvYWJici0xPjwvYWx0LXBlcmlvZGljYWw+PHBh

Z2VzPjY4LTczPC9wYWdlcz48dm9sdW1lPjIxPC92b2x1bWU+PG51bWJlcj4xPC9udW1iZXI+PGVk

aXRpb24+MjAwOC8wNi8xMzwvZWRpdGlvbj48a2V5d29yZHM+PGtleXdvcmQ+QWRlbm9zaW5lIFRy

aXBob3NwaGF0ZS9tZXRhYm9saXNtPC9rZXl3b3JkPjxrZXl3b3JkPkFuaW1hbHM8L2tleXdvcmQ+

PGtleXdvcmQ+QW50aW94aWRhbnRzL2NoZW1pc3RyeS8gcGhhcm1hY29sb2d5PC9rZXl3b3JkPjxr

ZXl3b3JkPkVyeXRocm9jeXRlcy8gZHJ1ZyBlZmZlY3RzL21ldGFib2xpc208L2tleXdvcmQ+PGtl

eXdvcmQ+SGVtb2x5c2lzL2RydWcgZWZmZWN0czwva2V5d29yZD48a2V5d29yZD5IdW1hbnM8L2tl

eXdvcmQ+PGtleXdvcmQ+TGlwb3Byb3RlaW5zL21ldGFib2xpc208L2tleXdvcmQ+PGtleXdvcmQ+

TmV1cm9ucy8gZHJ1ZyBlZmZlY3RzL21ldGFib2xpc208L2tleXdvcmQ+PGtleXdvcmQ+T2xpZ29w

ZXB0aWRlcy9jaGVtaXN0cnkvIHBoYXJtYWNvbG9neTwva2V5d29yZD48a2V5d29yZD5PeGlkYXRp

b24tUmVkdWN0aW9uPC9rZXl3b3JkPjxrZXl3b3JkPlJhdHM8L2tleXdvcmQ+PGtleXdvcmQ+UmF0

cywgV2lzdGFyPC9rZXl3b3JkPjxrZXl3b3JkPlJlYWN0aXZlIE5pdHJvZ2VuIFNwZWNpZXMvIG1l

dGFib2xpc208L2tleXdvcmQ+PC9rZXl3b3Jkcz48ZGF0ZXM+PHllYXI+MjAwODwveWVhcj48L2Rh

dGVzPjxpc2JuPjE1NjEtOTEyNSAoUHJpbnQpJiN4RDsxNTYxLTkxMjUgKExpbmtpbmcpPC9pc2Ju

PjxhY2Nlc3Npb24tbnVtPjE4NTQ2ODI2PC9hY2Nlc3Npb24tbnVtPjx1cmxzPjwvdXJscz48cmVt

b3RlLWRhdGFiYXNlLXByb3ZpZGVyPk5MTTwvcmVtb3RlLWRhdGFiYXNlLXByb3ZpZGVyPjxsYW5n

dWFnZT5ydXM8L2xhbmd1YWdlPjwvcmVjb3JkPjwvQ2l0ZT48Q2l0ZT48QXV0aG9yPkFydXRqdW55

YW48L0F1dGhvcj48WWVhcj4yMDEyPC9ZZWFyPjxSZWNOdW0+Mjk0PC9SZWNOdW0+PHJlY29yZD48

cmVjLW51bWJlcj4yOTQ8L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5IGFwcD0iRU4iIGRi

LWlkPSJ3MndmeGFmZTZ2YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjI5NDwva2V5PjwvZm9y

ZWlnbi1rZXlzPjxyZWYtdHlwZSBuYW1lPSJKb3VybmFsIEFydGljbGUiPjE3PC9yZWYtdHlwZT48

Y29udHJpYnV0b3JzPjxhdXRob3JzPjxhdXRob3I+QXJ1dGp1bnlhbiwgQS48L2F1dGhvcj48YXV0

aG9yPktvemluYSwgTC48L2F1dGhvcj48YXV0aG9yPlN0dm9saW5za2l5LCBTLjwvYXV0aG9yPjxh

dXRob3I+QnVseWdpbmEsIFkuPC9hdXRob3I+PGF1dGhvcj5NYXNoa2luYSwgQS48L2F1dGhvcj48

YXV0aG9yPktoYXZpbnNvbiwgVi48L2F1dGhvcj48L2F1dGhvcnM+PC9jb250cmlidXRvcnM+PHRp

dGxlcz48dGl0bGU+UGluZWFsb24gcHJvdGVjdHMgdGhlIHJhdCBvZmZzcHJpbmcgZnJvbSBwcmVu

YXRhbCBoeXBlcmhvbW9jeXN0ZWluZW1pYTwvdGl0bGU+PHNlY29uZGFyeS10aXRsZT5JbnQgSiBD

bGluIEV4cCBNZWQ8L3NlY29uZGFyeS10aXRsZT48YWx0LXRpdGxlPkludGVybmF0aW9uYWwgam91

cm5hbCBvZiBjbGluaWNhbCBhbmQgZXhwZXJpbWVudGFsIG1lZGljaW5lPC9hbHQtdGl0bGU+PC90

aXRsZXM+PHBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+SW50IEogQ2xpbiBFeHAgTWVkPC9mdWxsLXRp

dGxlPjxhYmJyLTE+SW50ZXJuYXRpb25hbCBqb3VybmFsIG9mIGNsaW5pY2FsIGFuZCBleHBlcmlt

ZW50YWwgbWVkaWNpbmU8L2FiYnItMT48L3BlcmlvZGljYWw+PGFsdC1wZXJpb2RpY2FsPjxmdWxs

LXRpdGxlPkludCBKIENsaW4gRXhwIE1lZDwvZnVsbC10aXRsZT48YWJici0xPkludGVybmF0aW9u

YWwgam91cm5hbCBvZiBjbGluaWNhbCBhbmQgZXhwZXJpbWVudGFsIG1lZGljaW5lPC9hYmJyLTE+

PC9hbHQtcGVyaW9kaWNhbD48cGFnZXM+MTc5LTg1PC9wYWdlcz48dm9sdW1lPjU8L3ZvbHVtZT48

bnVtYmVyPjI8L251bWJlcj48ZWRpdGlvbj4yMDEyLzA1LzA5PC9lZGl0aW9uPjxkYXRlcz48eWVh

cj4yMDEyPC95ZWFyPjwvZGF0ZXM+PGlzYm4+MTk0MC01OTAxIChFbGVjdHJvbmljKSYjeEQ7MTk0

MC01OTAxIChMaW5raW5nKTwvaXNibj48YWNjZXNzaW9uLW51bT4yMjU2NzE3OTwvYWNjZXNzaW9u

LW51bT48dXJscz48L3VybHM+PGN1c3RvbTI+UE1DMzM0MjcxMzwvY3VzdG9tMj48cmVtb3RlLWRh

dGFiYXNlLXByb3ZpZGVyPk5MTTwvcmVtb3RlLWRhdGFiYXNlLXByb3ZpZGVyPjxsYW5ndWFnZT5l

bmc8L2xhbmd1YWdlPjwvcmVjb3JkPjwvQ2l0ZT48L0VuZE5vdGU+AG==

ADDIN EN.CITE PEVuZE5vdGU+PENpdGU+PEF1dGhvcj5Lb3ppbmE8L0F1dGhvcj48WWVhcj4yMDA4PC9ZZWFyPjxS

ZWNOdW0+Mjk3PC9SZWNOdW0+PERpc3BsYXlUZXh0PlsyNDQtMjQ2XTwvRGlzcGxheVRleHQ+PHJl

Y29yZD48cmVjLW51bWJlcj4yOTc8L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5IGFwcD0i

RU4iIGRiLWlkPSJ3MndmeGFmZTZ2YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjI5Nzwva2V5

PjwvZm9yZWlnbi1rZXlzPjxyZWYtdHlwZSBuYW1lPSJKb3VybmFsIEFydGljbGUiPjE3PC9yZWYt

dHlwZT48Y29udHJpYnV0b3JzPjxhdXRob3JzPjxhdXRob3I+S296aW5hLCBMLiBTLjwvYXV0aG9y

PjwvYXV0aG9ycz48L2NvbnRyaWJ1dG9ycz48dGl0bGVzPjx0aXRsZT5bSW52ZXN0aWdhdGlvbiBv

ZiBhbnRpaHlwb3hpYyBwcm9wZXJ0aWVzIG9mIHNob3J0IHBlcHRpZGVzXTwvdGl0bGU+PHNlY29u

ZGFyeS10aXRsZT5BZHYgR2Vyb250b2w8L3NlY29uZGFyeS10aXRsZT48YWx0LXRpdGxlPkFkdmFu

Y2VzIGluIGdlcm9udG9sb2d5ID0gVXNwZWtoaSBnZXJvbnRvbG9naWkgLyBSb3NzaWlza2FpYSBh

a2FkZW1paWEgbmF1aywgR2Vyb250b2xvZ2ljaGVza29lIG9ic2hjaGVzdHZvPC9hbHQtdGl0bGU+

PC90aXRsZXM+PHBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+QWR2IEdlcm9udG9sPC9mdWxsLXRpdGxl

PjxhYmJyLTE+QWR2YW5jZXMgaW4gZ2Vyb250b2xvZ3kgPSBVc3Bla2hpIGdlcm9udG9sb2dpaSAv

IFJvc3NpaXNrYWlhIGFrYWRlbWlpYSBuYXVrLCBHZXJvbnRvbG9naWNoZXNrb2Ugb2JzaGNoZXN0

dm88L2FiYnItMT48L3BlcmlvZGljYWw+PGFsdC1wZXJpb2RpY2FsPjxmdWxsLXRpdGxlPkFkdiBH

ZXJvbnRvbDwvZnVsbC10aXRsZT48YWJici0xPkFkdmFuY2VzIGluIGdlcm9udG9sb2d5ID0gVXNw

ZWtoaSBnZXJvbnRvbG9naWkgLyBSb3NzaWlza2FpYSBha2FkZW1paWEgbmF1aywgR2Vyb250b2xv

Z2ljaGVza29lIG9ic2hjaGVzdHZvPC9hYmJyLTE+PC9hbHQtcGVyaW9kaWNhbD48cGFnZXM+NjEt

NzwvcGFnZXM+PHZvbHVtZT4yMTwvdm9sdW1lPjxudW1iZXI+MTwvbnVtYmVyPjxlZGl0aW9uPjIw

MDgvMDYvMTM8L2VkaXRpb24+PGtleXdvcmRzPjxrZXl3b3JkPkFkYXB0YXRpb24sIFBoeXNpb2xv

Z2ljYWwvZHJ1ZyBlZmZlY3RzPC9rZXl3b3JkPjxrZXl3b3JkPkFkZW5vc2luZSBUcmlwaG9zcGhh

dGUvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5BbmltYWxzPC9rZXl3b3JkPjxrZXl3b3Jk

PkFub3hpYS9jb21wbGljYXRpb25zL3BoeXNpb3BhdGhvbG9neS9wcmV2ZW50aW9uICZhbXA7IGNv

bnRyb2w8L2tleXdvcmQ+PGtleXdvcmQ+QmVoYXZpb3IsIEFuaW1hbC9kcnVnIGVmZmVjdHM8L2tl

eXdvcmQ+PGtleXdvcmQ+QnJhaW4vIGRydWcgZWZmZWN0cy9lbnp5bW9sb2d5L2dyb3d0aCAmYW1w

OyBkZXZlbG9wbWVudC9wYXRob2xvZ3k8L2tleXdvcmQ+PGtleXdvcmQ+RmVtYWxlPC9rZXl3b3Jk

PjxrZXl3b3JkPkdsdXRhdGhpb25lIFBlcm94aWRhc2UvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5

d29yZD5MaXZlci9kcnVnIGVmZmVjdHMvZW56eW1vbG9neS9ncm93dGggJmFtcDsgZGV2ZWxvcG1l

bnQvcGF0aG9sb2d5PC9rZXl3b3JkPjxrZXl3b3JkPk1hbGU8L2tleXdvcmQ+PGtleXdvcmQ+TmV1

cm9wcm90ZWN0aXZlIEFnZW50cy9jaGVtaXN0cnkvcGhhcm1hY29sb2d5LyB0aGVyYXBldXRpYyB1

c2U8L2tleXdvcmQ+PGtleXdvcmQ+T2xpZ29wZXB0aWRlcy9jaGVtaXN0cnkvcGhhcm1hY29sb2d5

LyB0aGVyYXBldXRpYyB1c2U8L2tleXdvcmQ+PGtleXdvcmQ+T3hpZGF0aXZlIFN0cmVzcy9kcnVn

IGVmZmVjdHM8L2tleXdvcmQ+PGtleXdvcmQ+UHJlZ25hbmN5PC9rZXl3b3JkPjxrZXl3b3JkPlBy

ZW5hdGFsIEV4cG9zdXJlIERlbGF5ZWQgRWZmZWN0cy9ldGlvbG9neS9waHlzaW9wYXRob2xvZ3kv

cHJldmVudGlvbiAmYW1wOyBjb250cm9sPC9rZXl3b3JkPjxrZXl3b3JkPlJhdHM8L2tleXdvcmQ+

PGtleXdvcmQ+UmF0cywgV2lzdGFyPC9rZXl3b3JkPjxrZXl3b3JkPlJlc3BpcmF0b3J5IFBoeXNp

b2xvZ2ljYWwgUGhlbm9tZW5hL2RydWcgZWZmZWN0czwva2V5d29yZD48a2V5d29yZD5TdXBlcm94

aWRlIERpc211dGFzZS9tZXRhYm9saXNtPC9rZXl3b3JkPjwva2V5d29yZHM+PGRhdGVzPjx5ZWFy

PjIwMDg8L3llYXI+PC9kYXRlcz48aXNibj4xNTYxLTkxMjUgKFByaW50KSYjeEQ7MTU2MS05MTI1

IChMaW5raW5nKTwvaXNibj48YWNjZXNzaW9uLW51bT4xODU0NjgyNTwvYWNjZXNzaW9uLW51bT48

dXJscz48L3VybHM+PHJlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj5OTE08L3JlbW90ZS1kYXRhYmFz

ZS1wcm92aWRlcj48bGFuZ3VhZ2U+cnVzPC9sYW5ndWFnZT48L3JlY29yZD48L0NpdGU+PENpdGU+

PEF1dGhvcj5Lb3ppbmE8L0F1dGhvcj48WWVhcj4yMDA4PC9ZZWFyPjxSZWNOdW0+Mjk2PC9SZWNO

dW0+PHJlY29yZD48cmVjLW51bWJlcj4yOTY8L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5

IGFwcD0iRU4iIGRiLWlkPSJ3MndmeGFmZTZ2YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjI5

Njwva2V5PjwvZm9yZWlnbi1rZXlzPjxyZWYtdHlwZSBuYW1lPSJKb3VybmFsIEFydGljbGUiPjE3

PC9yZWYtdHlwZT48Y29udHJpYnV0b3JzPjxhdXRob3JzPjxhdXRob3I+S296aW5hLCBMLiBTLjwv

YXV0aG9yPjxhdXRob3I+QXJ1dGl1bmlhbiwgQS4gVi48L2F1dGhvcj48YXV0aG9yPlN0dm9saW5z

a2lpLCBTLiBMLjwvYXV0aG9yPjxhdXRob3I+S2hhdmluc29uLCBWS2g8L2F1dGhvcj48L2F1dGhv

cnM+PC9jb250cmlidXRvcnM+PHRpdGxlcz48dGl0bGU+W0Jpb2xvZ2ljYWwgYWN0aXZpdHkgb2Yg

cmVndWxhdG9yeSBwZXB0aWRlcyBpbiBtb2RlbCBleHBlcmltZW50cyBpbiB2aXRyb108L3RpdGxl

PjxzZWNvbmRhcnktdGl0bGU+QWR2IEdlcm9udG9sPC9zZWNvbmRhcnktdGl0bGU+PGFsdC10aXRs

ZT5BZHZhbmNlcyBpbiBnZXJvbnRvbG9neSA9IFVzcGVraGkgZ2Vyb250b2xvZ2lpIC8gUm9zc2lp

c2thaWEgYWthZGVtaWlhIG5hdWssIEdlcm9udG9sb2dpY2hlc2tvZSBvYnNoY2hlc3R2bzwvYWx0

LXRpdGxlPjwvdGl0bGVzPjxwZXJpb2RpY2FsPjxmdWxsLXRpdGxlPkFkdiBHZXJvbnRvbDwvZnVs

bC10aXRsZT48YWJici0xPkFkdmFuY2VzIGluIGdlcm9udG9sb2d5ID0gVXNwZWtoaSBnZXJvbnRv

bG9naWkgLyBSb3NzaWlza2FpYSBha2FkZW1paWEgbmF1aywgR2Vyb250b2xvZ2ljaGVza29lIG9i

c2hjaGVzdHZvPC9hYmJyLTE+PC9wZXJpb2RpY2FsPjxhbHQtcGVyaW9kaWNhbD48ZnVsbC10aXRs

ZT5BZHYgR2Vyb250b2w8L2Z1bGwtdGl0bGU+PGFiYnItMT5BZHZhbmNlcyBpbiBnZXJvbnRvbG9n

eSA9IFVzcGVraGkgZ2Vyb250b2xvZ2lpIC8gUm9zc2lpc2thaWEgYWthZGVtaWlhIG5hdWssIEdl

cm9udG9sb2dpY2hlc2tvZSBvYnNoY2hlc3R2bzwvYWJici0xPjwvYWx0LXBlcmlvZGljYWw+PHBh

Z2VzPjY4LTczPC9wYWdlcz48dm9sdW1lPjIxPC92b2x1bWU+PG51bWJlcj4xPC9udW1iZXI+PGVk

aXRpb24+MjAwOC8wNi8xMzwvZWRpdGlvbj48a2V5d29yZHM+PGtleXdvcmQ+QWRlbm9zaW5lIFRy

aXBob3NwaGF0ZS9tZXRhYm9saXNtPC9rZXl3b3JkPjxrZXl3b3JkPkFuaW1hbHM8L2tleXdvcmQ+

PGtleXdvcmQ+QW50aW94aWRhbnRzL2NoZW1pc3RyeS8gcGhhcm1hY29sb2d5PC9rZXl3b3JkPjxr

ZXl3b3JkPkVyeXRocm9jeXRlcy8gZHJ1ZyBlZmZlY3RzL21ldGFib2xpc208L2tleXdvcmQ+PGtl

eXdvcmQ+SGVtb2x5c2lzL2RydWcgZWZmZWN0czwva2V5d29yZD48a2V5d29yZD5IdW1hbnM8L2tl

eXdvcmQ+PGtleXdvcmQ+TGlwb3Byb3RlaW5zL21ldGFib2xpc208L2tleXdvcmQ+PGtleXdvcmQ+

TmV1cm9ucy8gZHJ1ZyBlZmZlY3RzL21ldGFib2xpc208L2tleXdvcmQ+PGtleXdvcmQ+T2xpZ29w

ZXB0aWRlcy9jaGVtaXN0cnkvIHBoYXJtYWNvbG9neTwva2V5d29yZD48a2V5d29yZD5PeGlkYXRp

b24tUmVkdWN0aW9uPC9rZXl3b3JkPjxrZXl3b3JkPlJhdHM8L2tleXdvcmQ+PGtleXdvcmQ+UmF0

cywgV2lzdGFyPC9rZXl3b3JkPjxrZXl3b3JkPlJlYWN0aXZlIE5pdHJvZ2VuIFNwZWNpZXMvIG1l

dGFib2xpc208L2tleXdvcmQ+PC9rZXl3b3Jkcz48ZGF0ZXM+PHllYXI+MjAwODwveWVhcj48L2Rh

dGVzPjxpc2JuPjE1NjEtOTEyNSAoUHJpbnQpJiN4RDsxNTYxLTkxMjUgKExpbmtpbmcpPC9pc2Ju

PjxhY2Nlc3Npb24tbnVtPjE4NTQ2ODI2PC9hY2Nlc3Npb24tbnVtPjx1cmxzPjwvdXJscz48cmVt

b3RlLWRhdGFiYXNlLXByb3ZpZGVyPk5MTTwvcmVtb3RlLWRhdGFiYXNlLXByb3ZpZGVyPjxsYW5n

dWFnZT5ydXM8L2xhbmd1YWdlPjwvcmVjb3JkPjwvQ2l0ZT48Q2l0ZT48QXV0aG9yPkFydXRqdW55

YW48L0F1dGhvcj48WWVhcj4yMDEyPC9ZZWFyPjxSZWNOdW0+Mjk0PC9SZWNOdW0+PHJlY29yZD48

cmVjLW51bWJlcj4yOTQ8L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5IGFwcD0iRU4iIGRi

LWlkPSJ3MndmeGFmZTZ2YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjI5NDwva2V5PjwvZm9y

ZWlnbi1rZXlzPjxyZWYtdHlwZSBuYW1lPSJKb3VybmFsIEFydGljbGUiPjE3PC9yZWYtdHlwZT48

Y29udHJpYnV0b3JzPjxhdXRob3JzPjxhdXRob3I+QXJ1dGp1bnlhbiwgQS48L2F1dGhvcj48YXV0

aG9yPktvemluYSwgTC48L2F1dGhvcj48YXV0aG9yPlN0dm9saW5za2l5LCBTLjwvYXV0aG9yPjxh

dXRob3I+QnVseWdpbmEsIFkuPC9hdXRob3I+PGF1dGhvcj5NYXNoa2luYSwgQS48L2F1dGhvcj48

YXV0aG9yPktoYXZpbnNvbiwgVi48L2F1dGhvcj48L2F1dGhvcnM+PC9jb250cmlidXRvcnM+PHRp

dGxlcz48dGl0bGU+UGluZWFsb24gcHJvdGVjdHMgdGhlIHJhdCBvZmZzcHJpbmcgZnJvbSBwcmVu

YXRhbCBoeXBlcmhvbW9jeXN0ZWluZW1pYTwvdGl0bGU+PHNlY29uZGFyeS10aXRsZT5JbnQgSiBD

bGluIEV4cCBNZWQ8L3NlY29uZGFyeS10aXRsZT48YWx0LXRpdGxlPkludGVybmF0aW9uYWwgam91

cm5hbCBvZiBjbGluaWNhbCBhbmQgZXhwZXJpbWVudGFsIG1lZGljaW5lPC9hbHQtdGl0bGU+PC90

aXRsZXM+PHBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+SW50IEogQ2xpbiBFeHAgTWVkPC9mdWxsLXRp

dGxlPjxhYmJyLTE+SW50ZXJuYXRpb25hbCBqb3VybmFsIG9mIGNsaW5pY2FsIGFuZCBleHBlcmlt

ZW50YWwgbWVkaWNpbmU8L2FiYnItMT48L3BlcmlvZGljYWw+PGFsdC1wZXJpb2RpY2FsPjxmdWxs

LXRpdGxlPkludCBKIENsaW4gRXhwIE1lZDwvZnVsbC10aXRsZT48YWJici0xPkludGVybmF0aW9u

YWwgam91cm5hbCBvZiBjbGluaWNhbCBhbmQgZXhwZXJpbWVudGFsIG1lZGljaW5lPC9hYmJyLTE+

PC9hbHQtcGVyaW9kaWNhbD48cGFnZXM+MTc5LTg1PC9wYWdlcz48dm9sdW1lPjU8L3ZvbHVtZT48

bnVtYmVyPjI8L251bWJlcj48ZWRpdGlvbj4yMDEyLzA1LzA5PC9lZGl0aW9uPjxkYXRlcz48eWVh

cj4yMDEyPC95ZWFyPjwvZGF0ZXM+PGlzYm4+MTk0MC01OTAxIChFbGVjdHJvbmljKSYjeEQ7MTk0

MC01OTAxIChMaW5raW5nKTwvaXNibj48YWNjZXNzaW9uLW51bT4yMjU2NzE3OTwvYWNjZXNzaW9u

LW51bT48dXJscz48L3VybHM+PGN1c3RvbTI+UE1DMzM0MjcxMzwvY3VzdG9tMj48cmVtb3RlLWRh

dGFiYXNlLXByb3ZpZGVyPk5MTTwvcmVtb3RlLWRhdGFiYXNlLXByb3ZpZGVyPjxsYW5ndWFnZT5l

bmc8L2xhbmd1YWdlPjwvcmVjb3JkPjwvQ2l0ZT48L0VuZE5vdGU+AG==

ADDIN EN.CITE.DATA [244-246]. Для изучения эффекта пинеалона на внутриклеточный уровень АФК клетки РС-12 обрабатывали пинеалоном (50 – 500 нМ) в течение 1 ч, а затем индуцировали окислительный стресс добавлением 1 мМ пероксида водорода (Н2О2) на 20 мин. Уровень АФК измеряли с помощью проточного цитометра по степени окисления флуоресцентного красителя DCFH2-DA. Процент погибших клеток определяли по количеству клеток окрашенных PI. Результаты измерения внутриклеточного уровня АФК и процента погибших клеток представлены на Рис. 3.1.5. Как видно из Рис. 3.1.5.А. обработка клеток РС-12 пинеалоном 50 - 500 нМ приводила к снижению внутриклеточного уровня АФК на 40% по сравнению с контролем. Добавление Н2О2 индуцировало рост АФК. Уровень АФК в пробах обработанных 1 мМ Н2О2 в 5 раз превышал значение в контроле. Инкубация клеток с пинеалоном частично препятствовала увеличению уровня АФК под действием Н2О2. Клетки, обработанные пинеалоном (50 - 500 нМ) перед добавлением Н2О2, демонстрировали в 2 раза меньший уровень АФК, чем клетки обработанные только Н2О2. Параллельно с повышением уровня АФК под действием Н2О2 происходило увеличение клеточной гибели. В пробах обработанных Н2О2 количество погибших клеток составляло 42,5% по сравнению с 5% в контроле. Пинеалон (50 – 500 нМ) снижал количество погибших клеток до 32,5 – 20% (Рис. 3.1.5.Б). Таким образом, было продемонстрировано, что пинеалон снижает внутриклеточный уровень АФК, предотвращает развитие окислительного стресса индуцированного действием Н2О2 и защищает клетки РС-12 от гибели.

Рисунок 3.1.

5. Пинеалон снижает уровень АФК в клетках РС-12 и уменьшает клеточную гибель. Клетки обрабатывали пинеалоном (50 – 500 нМ), через 1 час добавляли 1 мМ пероксида водорода (Н2О2), инкубировали 20 мин и анализировали на проточном цитометре. (А) Уровень АФК в контроле и в клетках обработанных пинеалоном и Н2О2 измеренный по степени окисления флуоресцентного красителя DCFH2-DA. (Б) Процент погибших клеток определенный по количеству клеток окрашенных PI. Звездочки обозначают статистически значимое отличие от количества клеток в контроле (*) или в присутствии 1 мМ Н2О2 (**); n=3, p<0.05.

Для того чтобы выяснить, способен ли пинеалон ввиду своих антиоксидантных свойств модифицировать прогрессию клеточного цикла клетки РС-12 обрабатывали пинеалоном (50 - 500 нМ) в течение 24 ч и с помощью проточного цитометра анализировали распределение клеток по фазам клеточного цикла согласно содержанию ДНК.

177806350Рисунок 3.1.6. Пинеалон индуцирует накопление клеток в S и G2/М фазах клеточного цикла. Клетки обрабатывали пинеалоном (50 - 500 нМ) в течение 24 часов. Распределение клеток по фазам клеточного цикла анализировали на проточном цитометре по интенсивности флуоресценции PI. (А) Пример распределения клеток по фазам клеточного цикла в контроле и после обработки пинеалоном. (В) Процентное распределение клеток по фазам клеточного цикла. Звездочка обозначает статистически значимое отличие от количества клеток в контроле; n=3, p<0.05.

На Рис. 3.1.6.А. представлен пример распределения клеток по фазам клеточного цикла в контроле и после обработки пинеалоном 100 нМ. Процентное распределение клеток между G0/G1, S и G2/М фазами в контроле и в пробах обработанных пинеалоном (50 – 500 нМ) показано на Рис. 3.1.6.Б. Как следует из Рис. 3.1.6.Б, пинеалон приводил к дозо-зависимому увеличению количества клеток в S и G2/М фазах и снижению количества клеток в G0/G1 фазе. Распределение в контроле составляло: G0/G1 - 70%, S - 14%, G2/М - 16%. Достоверно отличимый от контроля результат был получен в клетках, обработанных 100 нМ и 500 нМ пинеалона и составлял, соответственно: G0/G1 - 55%, S - 21%, G2/М -24% и G0/G1 - 50%, S - 24%, G2/М - 26%. Существенного влияния пинеалона на количество апоптотических клеток выявлено не было (Рис. 3.1.6.Б). Исходя из полученных, данных был сделано предположение о том, что пинеалон проявляет антиоксидантные свойства в клетках РС-12, а также индуцирует накопление клеток в G2/М фазе клеточного цикла.

Заключение I: Ингибирующее действие карнозина на пролиферацию клеток феохромоцитомы крысы РС-12 сопровождалось модификацией клеточного цикла и накоплением клеток в S и G2/М фазах. Метилирование карнозина приводило к усилению формирования G2-блока, а ацетилирование молекулы этот эффект ослабляло. L-гистидин--аланин (т.н. “карнозин наоборот”) демонстрировал в 5 раз большую эффективность по сравнению с карнозином, однако обладал сильным цитотоксическим эффектом. Синтетический трипептид пениалон также демонстрировал антиоксидантные свойства и индуцировал накопление клеток в S и G2/М фазах. Однако концентрации пинеалона были на несколько порядков ниже, чем для карнозина. Поскольку изменениям в прогрессии клеточного цикла под действием карнозина предшествовало снижение внутриклеточного уровня АФК, было предположено, что существует взаимосвязь между антипролиферативным и антиоксидантным эффектами карнозина.

РАЗДЕЛ 3.2.

Изучение механизма регуляции клеточного цикла под действием карнозинаИсследования механизма антипролиферативного эффекта карнозина были продолжены с использованием культур опухолевых клеток человека, так как именно они представляют собой первостепенную важность и имеют перспективу применения полученных данных на практике.

3.2.1. Карнозин избирательно ингибирует пролиферацию клеток глиобластомыДля изучения характера влияния карнозина на пролиферацию опухолевых клеток человека были выбраны четыре клеточные культуры: карцинома горла и рта (FaDu, Cal27), карцинома молочной железы (MB231), глиобластома (U-118-MG). Клетки всех четырех культур обрабатывали карнозином (40 мМ) и оставляли инкубироваться. Каждые два дня в течение 6 дней клетки подсчитывали и вычисляли время удвоения популяции (Td). Результаты действия карнозина (40 мМ) на пролиферацию исследуемых линий опухолевых клеток представлены на Рис. 3.2.1. Как следует из Рис. 3.2.1. карнозин приводил к увеличению Td всех исследованных клеточных линий. Для интактных клеток Td составляло: 18 ч (FaDu), 16 ч (Cal27), 22 ч (MB231) и 24 ч (U-118-MG). После инкубации с карнозином Td возрастало до: 19 ч (FaDu), 18 ч (Cal27), 26 ч (MB231) и 32 ч (U-118-MG). Увеличение Td под действием карнозина свидетельствовало о замедлении процессов клеточной пролиферации. Наибольшее увеличение Td было отмечено в клетках глиобластомы (Рис. 3.2.1).

209553810Рисунок 3.2.1. Карнозин избирательно ингибирует пролиферацию клеток глиобластомы. Клетки обрабатывали карнозином (40 мМ) Время удвоения популяций (Td) вычисляли по формуле: Td=0.693t/ln(Nt/N0), где t – время (дни), N0 – начальное количество клеток, Nt – количество клеток ко дню t.

Различия в эффективности действия карнозина на опухолевые клетки могут быть связаны с различиями в экспрессии внутриклеточных ферментов, отвечающих за синтез и разрушение карнозина. В организме человека карнозин синтезируется с помощь фермента карнозинсинтетазы из -аланина и L-гистидина с использованием энергии молекулы АТФ PEVuZE5vdGU+PENpdGU+PEF1dGhvcj5IYXJtczwvQXV0aG9yPjxZZWFyPjE5NTQ8L1llYXI+PFJl

Y051bT44MjwvUmVjTnVtPjxEaXNwbGF5VGV4dD5bNiwgMjU4XTwvRGlzcGxheVRleHQ+PHJlY29y

ZD48cmVjLW51bWJlcj44MjwvcmVjLW51bWJlcj48Zm9yZWlnbi1rZXlzPjxrZXkgYXBwPSJFTiIg

ZGItaWQ9Incyd2Z4YWZlNnZhOXo1ZWV2Mmw1NWFhOHN4c2E1OTllZXYycyI+ODI8L2tleT48L2Zv

cmVpZ24ta2V5cz48cmVmLXR5cGUgbmFtZT0iSm91cm5hbCBBcnRpY2xlIj4xNzwvcmVmLXR5cGU+

PGNvbnRyaWJ1dG9ycz48YXV0aG9ycz48YXV0aG9yPkhhcm1zLCBXLiBTLjwvYXV0aG9yPjxhdXRo

b3I+V2lubmljaywgVC48L2F1dGhvcj48L2F1dGhvcnM+PC9jb250cmlidXRvcnM+PHRpdGxlcz48

dGl0bGU+RnVydGhlciBzdHVkaWVzIG9mIHRoZSBiaW9zeW50aGVzaXMgb2YgY2Fybm9zaW5lIGFu

ZCBhbnNlcmluZSBpbiB2ZXJ0ZWJyYXRlczwvdGl0bGU+PHNlY29uZGFyeS10aXRsZT5CaW9jaGlt

IEJpb3BoeXMgQWN0YTwvc2Vjb25kYXJ5LXRpdGxlPjxhbHQtdGl0bGU+QmlvY2hpbWljYSBldCBi

aW9waHlzaWNhIGFjdGE8L2FsdC10aXRsZT48L3RpdGxlcz48cGVyaW9kaWNhbD48ZnVsbC10aXRs

ZT5CaW9jaGltIEJpb3BoeXMgQWN0YTwvZnVsbC10aXRsZT48YWJici0xPkJpb2NoaW1pY2EgZXQg

YmlvcGh5c2ljYSBhY3RhPC9hYmJyLTE+PC9wZXJpb2RpY2FsPjxhbHQtcGVyaW9kaWNhbD48ZnVs

bC10aXRsZT5CaW9jaGltIEJpb3BoeXMgQWN0YTwvZnVsbC10aXRsZT48YWJici0xPkJpb2NoaW1p

Y2EgZXQgYmlvcGh5c2ljYSBhY3RhPC9hYmJyLTE+PC9hbHQtcGVyaW9kaWNhbD48cGFnZXM+NDgw

LTg8L3BhZ2VzPjx2b2x1bWU+MTU8L3ZvbHVtZT48bnVtYmVyPjQ8L251bWJlcj48ZWRpdGlvbj4x

OTU0LzEyLzAxPC9lZGl0aW9uPjxrZXl3b3Jkcz48a2V5d29yZD5BbnNlcmluZS8gbWV0YWJvbGlz

bTwva2V5d29yZD48a2V5d29yZD5DYXJub3NpbmUvIG1ldGFib2xpc208L2tleXdvcmQ+PC9rZXl3

b3Jkcz48ZGF0ZXM+PHllYXI+MTk1NDwveWVhcj48cHViLWRhdGVzPjxkYXRlPkRlYzwvZGF0ZT48

L3B1Yi1kYXRlcz48L2RhdGVzPjxpc2JuPjAwMDYtMzAwMiAoUHJpbnQpJiN4RDswMDA2LTMwMDIg

KExpbmtpbmcpPC9pc2JuPjxhY2Nlc3Npb24tbnVtPjEzMjMwMDk1PC9hY2Nlc3Npb24tbnVtPjx1

cmxzPjwvdXJscz48cmVtb3RlLWRhdGFiYXNlLXByb3ZpZGVyPk5MTTwvcmVtb3RlLWRhdGFiYXNl

LXByb3ZpZGVyPjxsYW5ndWFnZT5lbmc8L2xhbmd1YWdlPjwvcmVjb3JkPjwvQ2l0ZT48Q2l0ZT48

QXV0aG9yPkhvcmluaXNoaTwvQXV0aG9yPjxZZWFyPjE5Nzg8L1llYXI+PFJlY051bT4xMzk8L1Jl

Y051bT48cmVjb3JkPjxyZWMtbnVtYmVyPjEzOTwvcmVjLW51bWJlcj48Zm9yZWlnbi1rZXlzPjxr

ZXkgYXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZlNnZhOXo1ZWV2Mmw1NWFhOHN4c2E1OTllZXYycyI+

MTM5PC9rZXk+PC9mb3JlaWduLWtleXM+PHJlZi10eXBlIG5hbWU9IkpvdXJuYWwgQXJ0aWNsZSI+

MTc8L3JlZi10eXBlPjxjb250cmlidXRvcnM+PGF1dGhvcnM+PGF1dGhvcj5Ib3JpbmlzaGksIEgu

PC9hdXRob3I+PGF1dGhvcj5HcmlsbG8sIE0uPC9hdXRob3I+PGF1dGhvcj5NYXJnb2xpcywgRi4g

TC48L2F1dGhvcj48L2F1dGhvcnM+PC9jb250cmlidXRvcnM+PHRpdGxlcz48dGl0bGU+UHVyaWZp

Y2F0aW9uIGFuZCBjaGFyYWN0ZXJpemF0aW9uIG9mIGNhcm5vc2luZSBzeW50aGV0YXNlIGZyb20g

bW91c2Ugb2xmYWN0b3J5IGJ1bGJzPC90aXRsZT48c2Vjb25kYXJ5LXRpdGxlPkogTmV1cm9jaGVt

PC9zZWNvbmRhcnktdGl0bGU+PGFsdC10aXRsZT5Kb3VybmFsIG9mIG5ldXJvY2hlbWlzdHJ5PC9h

bHQtdGl0bGU+PC90aXRsZXM+PHBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+SiBOZXVyb2NoZW08L2Z1

bGwtdGl0bGU+PGFiYnItMT5Kb3VybmFsIG9mIG5ldXJvY2hlbWlzdHJ5PC9hYmJyLTE+PC9wZXJp

b2RpY2FsPjxhbHQtcGVyaW9kaWNhbD48ZnVsbC10aXRsZT5KIE5ldXJvY2hlbTwvZnVsbC10aXRs

ZT48YWJici0xPkpvdXJuYWwgb2YgbmV1cm9jaGVtaXN0cnk8L2FiYnItMT48L2FsdC1wZXJpb2Rp

Y2FsPjxwYWdlcz45MDktMTk8L3BhZ2VzPjx2b2x1bWU+MzE8L3ZvbHVtZT48bnVtYmVyPjQ8L251

bWJlcj48ZWRpdGlvbj4xOTc4LzEwLzAxPC9lZGl0aW9uPjxrZXl3b3Jkcz48a2V5d29yZD5Bbmlt

YWxzPC9rZXl3b3JkPjxrZXl3b3JkPkNhcm5vc2luZS9iaW9zeW50aGVzaXM8L2tleXdvcmQ+PGtl

eXdvcmQ+Q2F0aW9ucywgRGl2YWxlbnQ8L2tleXdvcmQ+PGtleXdvcmQ+Q2hpY2tlbnM8L2tleXdv

cmQ+PGtleXdvcmQ+SGlzdGlkaW5lL2FuYWxvZ3MgJmFtcDsgZGVyaXZhdGl2ZXMvcGhhcm1hY29s

b2d5PC9rZXl3b3JkPjxrZXl3b3JkPktpbmV0aWNzPC9rZXl3b3JkPjxrZXl3b3JkPk1hbGU8L2tl

eXdvcmQ+PGtleXdvcmQ+TWV0aG9kczwva2V5d29yZD48a2V5d29yZD5NaWNlPC9rZXl3b3JkPjxr

ZXl3b3JkPk11c2NsZXMvZW56eW1vbG9neTwva2V5d29yZD48a2V5d29yZD5PbGZhY3RvcnkgQnVs

Yi8gZW56eW1vbG9neTwva2V5d29yZD48a2V5d29yZD5QZXB0aWRlIFN5bnRoYXNlcy8gaXNvbGF0

aW9uICZhbXA7IHB1cmlmaWNhdGlvbjwva2V5d29yZD48a2V5d29yZD5iZXRhLUFsYW5pbmUvYW5h

bG9ncyAmYW1wOyBkZXJpdmF0aXZlcy9waGFybWFjb2xvZ3k8L2tleXdvcmQ+PC9rZXl3b3Jkcz48

ZGF0ZXM+PHllYXI+MTk3ODwveWVhcj48cHViLWRhdGVzPjxkYXRlPk9jdDwvZGF0ZT48L3B1Yi1k

YXRlcz48L2RhdGVzPjxpc2JuPjAwMjItMzA0MiAoUHJpbnQpJiN4RDswMDIyLTMwNDIgKExpbmtp

bmcpPC9pc2JuPjxhY2Nlc3Npb24tbnVtPjEwMDU3NjwvYWNjZXNzaW9uLW51bT48dXJscz48L3Vy

bHM+PHJlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj5OTE08L3JlbW90ZS1kYXRhYmFzZS1wcm92aWRl

cj48bGFuZ3VhZ2U+ZW5nPC9sYW5ndWFnZT48L3JlY29yZD48L0NpdGU+PC9FbmROb3RlPn==

ADDIN EN.CITE PEVuZE5vdGU+PENpdGU+PEF1dGhvcj5IYXJtczwvQXV0aG9yPjxZZWFyPjE5NTQ8L1llYXI+PFJl

Y051bT44MjwvUmVjTnVtPjxEaXNwbGF5VGV4dD5bNiwgMjU4XTwvRGlzcGxheVRleHQ+PHJlY29y

ZD48cmVjLW51bWJlcj44MjwvcmVjLW51bWJlcj48Zm9yZWlnbi1rZXlzPjxrZXkgYXBwPSJFTiIg

ZGItaWQ9Incyd2Z4YWZlNnZhOXo1ZWV2Mmw1NWFhOHN4c2E1OTllZXYycyI+ODI8L2tleT48L2Zv

cmVpZ24ta2V5cz48cmVmLXR5cGUgbmFtZT0iSm91cm5hbCBBcnRpY2xlIj4xNzwvcmVmLXR5cGU+

PGNvbnRyaWJ1dG9ycz48YXV0aG9ycz48YXV0aG9yPkhhcm1zLCBXLiBTLjwvYXV0aG9yPjxhdXRo

b3I+V2lubmljaywgVC48L2F1dGhvcj48L2F1dGhvcnM+PC9jb250cmlidXRvcnM+PHRpdGxlcz48

dGl0bGU+RnVydGhlciBzdHVkaWVzIG9mIHRoZSBiaW9zeW50aGVzaXMgb2YgY2Fybm9zaW5lIGFu

ZCBhbnNlcmluZSBpbiB2ZXJ0ZWJyYXRlczwvdGl0bGU+PHNlY29uZGFyeS10aXRsZT5CaW9jaGlt

IEJpb3BoeXMgQWN0YTwvc2Vjb25kYXJ5LXRpdGxlPjxhbHQtdGl0bGU+QmlvY2hpbWljYSBldCBi

aW9waHlzaWNhIGFjdGE8L2FsdC10aXRsZT48L3RpdGxlcz48cGVyaW9kaWNhbD48ZnVsbC10aXRs

ZT5CaW9jaGltIEJpb3BoeXMgQWN0YTwvZnVsbC10aXRsZT48YWJici0xPkJpb2NoaW1pY2EgZXQg

YmlvcGh5c2ljYSBhY3RhPC9hYmJyLTE+PC9wZXJpb2RpY2FsPjxhbHQtcGVyaW9kaWNhbD48ZnVs

bC10aXRsZT5CaW9jaGltIEJpb3BoeXMgQWN0YTwvZnVsbC10aXRsZT48YWJici0xPkJpb2NoaW1p

Y2EgZXQgYmlvcGh5c2ljYSBhY3RhPC9hYmJyLTE+PC9hbHQtcGVyaW9kaWNhbD48cGFnZXM+NDgw

LTg8L3BhZ2VzPjx2b2x1bWU+MTU8L3ZvbHVtZT48bnVtYmVyPjQ8L251bWJlcj48ZWRpdGlvbj4x

OTU0LzEyLzAxPC9lZGl0aW9uPjxrZXl3b3Jkcz48a2V5d29yZD5BbnNlcmluZS8gbWV0YWJvbGlz

bTwva2V5d29yZD48a2V5d29yZD5DYXJub3NpbmUvIG1ldGFib2xpc208L2tleXdvcmQ+PC9rZXl3

b3Jkcz48ZGF0ZXM+PHllYXI+MTk1NDwveWVhcj48cHViLWRhdGVzPjxkYXRlPkRlYzwvZGF0ZT48

L3B1Yi1kYXRlcz48L2RhdGVzPjxpc2JuPjAwMDYtMzAwMiAoUHJpbnQpJiN4RDswMDA2LTMwMDIg

KExpbmtpbmcpPC9pc2JuPjxhY2Nlc3Npb24tbnVtPjEzMjMwMDk1PC9hY2Nlc3Npb24tbnVtPjx1

cmxzPjwvdXJscz48cmVtb3RlLWRhdGFiYXNlLXByb3ZpZGVyPk5MTTwvcmVtb3RlLWRhdGFiYXNl

LXByb3ZpZGVyPjxsYW5ndWFnZT5lbmc8L2xhbmd1YWdlPjwvcmVjb3JkPjwvQ2l0ZT48Q2l0ZT48

QXV0aG9yPkhvcmluaXNoaTwvQXV0aG9yPjxZZWFyPjE5Nzg8L1llYXI+PFJlY051bT4xMzk8L1Jl

Y051bT48cmVjb3JkPjxyZWMtbnVtYmVyPjEzOTwvcmVjLW51bWJlcj48Zm9yZWlnbi1rZXlzPjxr

ZXkgYXBwPSJFTiIgZGItaWQ9Incyd2Z4YWZlNnZhOXo1ZWV2Mmw1NWFhOHN4c2E1OTllZXYycyI+

MTM5PC9rZXk+PC9mb3JlaWduLWtleXM+PHJlZi10eXBlIG5hbWU9IkpvdXJuYWwgQXJ0aWNsZSI+

MTc8L3JlZi10eXBlPjxjb250cmlidXRvcnM+PGF1dGhvcnM+PGF1dGhvcj5Ib3JpbmlzaGksIEgu

PC9hdXRob3I+PGF1dGhvcj5HcmlsbG8sIE0uPC9hdXRob3I+PGF1dGhvcj5NYXJnb2xpcywgRi4g

TC48L2F1dGhvcj48L2F1dGhvcnM+PC9jb250cmlidXRvcnM+PHRpdGxlcz48dGl0bGU+UHVyaWZp

Y2F0aW9uIGFuZCBjaGFyYWN0ZXJpemF0aW9uIG9mIGNhcm5vc2luZSBzeW50aGV0YXNlIGZyb20g

bW91c2Ugb2xmYWN0b3J5IGJ1bGJzPC90aXRsZT48c2Vjb25kYXJ5LXRpdGxlPkogTmV1cm9jaGVt

PC9zZWNvbmRhcnktdGl0bGU+PGFsdC10aXRsZT5Kb3VybmFsIG9mIG5ldXJvY2hlbWlzdHJ5PC9h

bHQtdGl0bGU+PC90aXRsZXM+PHBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+SiBOZXVyb2NoZW08L2Z1

bGwtdGl0bGU+PGFiYnItMT5Kb3VybmFsIG9mIG5ldXJvY2hlbWlzdHJ5PC9hYmJyLTE+PC9wZXJp

b2RpY2FsPjxhbHQtcGVyaW9kaWNhbD48ZnVsbC10aXRsZT5KIE5ldXJvY2hlbTwvZnVsbC10aXRs

ZT48YWJici0xPkpvdXJuYWwgb2YgbmV1cm9jaGVtaXN0cnk8L2FiYnItMT48L2FsdC1wZXJpb2Rp

Y2FsPjxwYWdlcz45MDktMTk8L3BhZ2VzPjx2b2x1bWU+MzE8L3ZvbHVtZT48bnVtYmVyPjQ8L251

bWJlcj48ZWRpdGlvbj4xOTc4LzEwLzAxPC9lZGl0aW9uPjxrZXl3b3Jkcz48a2V5d29yZD5Bbmlt

YWxzPC9rZXl3b3JkPjxrZXl3b3JkPkNhcm5vc2luZS9iaW9zeW50aGVzaXM8L2tleXdvcmQ+PGtl

eXdvcmQ+Q2F0aW9ucywgRGl2YWxlbnQ8L2tleXdvcmQ+PGtleXdvcmQ+Q2hpY2tlbnM8L2tleXdv

cmQ+PGtleXdvcmQ+SGlzdGlkaW5lL2FuYWxvZ3MgJmFtcDsgZGVyaXZhdGl2ZXMvcGhhcm1hY29s

b2d5PC9rZXl3b3JkPjxrZXl3b3JkPktpbmV0aWNzPC9rZXl3b3JkPjxrZXl3b3JkPk1hbGU8L2tl

eXdvcmQ+PGtleXdvcmQ+TWV0aG9kczwva2V5d29yZD48a2V5d29yZD5NaWNlPC9rZXl3b3JkPjxr

ZXl3b3JkPk11c2NsZXMvZW56eW1vbG9neTwva2V5d29yZD48a2V5d29yZD5PbGZhY3RvcnkgQnVs

Yi8gZW56eW1vbG9neTwva2V5d29yZD48a2V5d29yZD5QZXB0aWRlIFN5bnRoYXNlcy8gaXNvbGF0

aW9uICZhbXA7IHB1cmlmaWNhdGlvbjwva2V5d29yZD48a2V5d29yZD5iZXRhLUFsYW5pbmUvYW5h

bG9ncyAmYW1wOyBkZXJpdmF0aXZlcy9waGFybWFjb2xvZ3k8L2tleXdvcmQ+PC9rZXl3b3Jkcz48

ZGF0ZXM+PHllYXI+MTk3ODwveWVhcj48cHViLWRhdGVzPjxkYXRlPk9jdDwvZGF0ZT48L3B1Yi1k

YXRlcz48L2RhdGVzPjxpc2JuPjAwMjItMzA0MiAoUHJpbnQpJiN4RDswMDIyLTMwNDIgKExpbmtp

bmcpPC9pc2JuPjxhY2Nlc3Npb24tbnVtPjEwMDU3NjwvYWNjZXNzaW9uLW51bT48dXJscz48L3Vy

bHM+PHJlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj5OTE08L3JlbW90ZS1kYXRhYmFzZS1wcm92aWRl

cj48bGFuZ3VhZ2U+ZW5nPC9sYW5ndWFnZT48L3JlY29yZD48L0NpdGU+PC9FbmROb3RlPn==

ADDIN EN.CITE.DATA [6, 258]. Гидролиз карнозина на исходные аминокислоты осуществляется в основном с помощью сывороточной карнозиназы PEVuZE5vdGU+PENpdGU+PEF1dGhvcj5MZW5uZXk8L0F1dGhvcj48WWVhcj4xOTgyPC9ZZWFyPjxS

ZWNOdW0+ODk8L1JlY051bT48RGlzcGxheVRleHQ+WzksIDE5NV08L0Rpc3BsYXlUZXh0PjxyZWNv

cmQ+PHJlYy1udW1iZXI+ODk8L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5IGFwcD0iRU4i

IGRiLWlkPSJ3MndmeGFmZTZ2YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjg5PC9rZXk+PC9m

b3JlaWduLWtleXM+PHJlZi10eXBlIG5hbWU9IkpvdXJuYWwgQXJ0aWNsZSI+MTc8L3JlZi10eXBl

Pjxjb250cmlidXRvcnM+PGF1dGhvcnM+PGF1dGhvcj5MZW5uZXksIEouIEYuPC9hdXRob3I+PGF1

dGhvcj5HZW9yZ2UsIFIuIFAuPC9hdXRob3I+PGF1dGhvcj5XZWlzcywgQS4gTS48L2F1dGhvcj48

YXV0aG9yPkt1Y2VyYSwgQy4gTS48L2F1dGhvcj48YXV0aG9yPkNoYW4sIFAuIFcuPC9hdXRob3I+

PGF1dGhvcj5SaW56bGVyLCBHLiBTLjwvYXV0aG9yPjwvYXV0aG9ycz48L2NvbnRyaWJ1dG9ycz48

dGl0bGVzPjx0aXRsZT5IdW1hbiBzZXJ1bSBjYXJub3NpbmFzZTogY2hhcmFjdGVyaXphdGlvbiwg

ZGlzdGluY3Rpb24gZnJvbSBjZWxsdWxhciBjYXJub3NpbmFzZSwgYW5kIGFjdGl2YXRpb24gYnkg

Y2FkbWl1bTwvdGl0bGU+PHNlY29uZGFyeS10aXRsZT5DbGluIENoaW0gQWN0YTwvc2Vjb25kYXJ5

LXRpdGxlPjxhbHQtdGl0bGU+Q2xpbmljYSBjaGltaWNhIGFjdGE7IGludGVybmF0aW9uYWwgam91

cm5hbCBvZiBjbGluaWNhbCBjaGVtaXN0cnk8L2FsdC10aXRsZT48L3RpdGxlcz48cGVyaW9kaWNh

bD48ZnVsbC10aXRsZT5DbGluIENoaW0gQWN0YTwvZnVsbC10aXRsZT48YWJici0xPkNsaW5pY2Eg

Y2hpbWljYSBhY3RhOyBpbnRlcm5hdGlvbmFsIGpvdXJuYWwgb2YgY2xpbmljYWwgY2hlbWlzdHJ5

PC9hYmJyLTE+PC9wZXJpb2RpY2FsPjxhbHQtcGVyaW9kaWNhbD48ZnVsbC10aXRsZT5DbGluIENo

aW0gQWN0YTwvZnVsbC10aXRsZT48YWJici0xPkNsaW5pY2EgY2hpbWljYSBhY3RhOyBpbnRlcm5h

dGlvbmFsIGpvdXJuYWwgb2YgY2xpbmljYWwgY2hlbWlzdHJ5PC9hYmJyLTE+PC9hbHQtcGVyaW9k

aWNhbD48cGFnZXM+MjIxLTMxPC9wYWdlcz48dm9sdW1lPjEyMzwvdm9sdW1lPjxudW1iZXI+Mzwv

bnVtYmVyPjxlZGl0aW9uPjE5ODIvMDgvMTg8L2VkaXRpb24+PGtleXdvcmRzPjxrZXl3b3JkPkFk

b2xlc2NlbnQ8L2tleXdvcmQ+PGtleXdvcmQ+QWR1bHQ8L2tleXdvcmQ+PGtleXdvcmQ+QWdlZDwv

a2V5d29yZD48a2V5d29yZD5BZ2luZzwva2V5d29yZD48a2V5d29yZD5DYWRtaXVtLyBibG9vZDwv

a2V5d29yZD48a2V5d29yZD5DYXJub3NpbmUvYW5hbG9ncyAmYW1wOyBkZXJpdmF0aXZlcy9tZXRh

Ym9saXNtPC9rZXl3b3JkPjxrZXl3b3JkPkNoaWxkPC9rZXl3b3JkPjxrZXl3b3JkPkNoaWxkLCBQ

cmVzY2hvb2w8L2tleXdvcmQ+PGtleXdvcmQ+RGlwZXB0aWRhc2VzLyBibG9vZDwva2V5d29yZD48

a2V5d29yZD5Fbnp5bWUgQWN0aXZhdGlvbi9kcnVnIGVmZmVjdHM8L2tleXdvcmQ+PGtleXdvcmQ+

SHVtYW5zPC9rZXl3b3JkPjxrZXl3b3JkPkluZmFudDwva2V5d29yZD48a2V5d29yZD5Jc29lbGVj

dHJpYyBQb2ludDwva2V5d29yZD48a2V5d29yZD5Jc29lbnp5bWVzLyBibG9vZDwva2V5d29yZD48

a2V5d29yZD5LaW5ldGljczwva2V5d29yZD48a2V5d29yZD5NaWRkbGUgQWdlZDwva2V5d29yZD48

a2V5d29yZD5Nb2xlY3VsYXIgV2VpZ2h0PC9rZXl3b3JkPjxrZXl3b3JkPlN1YnN0cmF0ZSBTcGVj

aWZpY2l0eTwva2V5d29yZD48L2tleXdvcmRzPjxkYXRlcz48eWVhcj4xOTgyPC95ZWFyPjxwdWIt

ZGF0ZXM+PGRhdGU+QXVnIDE4PC9kYXRlPjwvcHViLWRhdGVzPjwvZGF0ZXM+PGlzYm4+MDAwOS04

OTgxIChQcmludCkmI3hEOzAwMDktODk4MSAoTGlua2luZyk8L2lzYm4+PGFjY2Vzc2lvbi1udW0+

NzExNjY0NDwvYWNjZXNzaW9uLW51bT48dXJscz48L3VybHM+PHJlbW90ZS1kYXRhYmFzZS1wcm92

aWRlcj5OTE08L3JlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj48bGFuZ3VhZ2U+ZW5nPC9sYW5ndWFn

ZT48L3JlY29yZD48L0NpdGU+PENpdGU+PEF1dGhvcj5UZXVmZWw8L0F1dGhvcj48WWVhcj4yMDAz

PC9ZZWFyPjxSZWNOdW0+OTk8L1JlY051bT48cmVjb3JkPjxyZWMtbnVtYmVyPjk5PC9yZWMtbnVt

YmVyPjxmb3JlaWduLWtleXM+PGtleSBhcHA9IkVOIiBkYi1pZD0idzJ3ZnhhZmU2dmE5ejVlZXYy

bDU1YWE4c3hzYTU5OWVldjJzIj45OTwva2V5PjwvZm9yZWlnbi1rZXlzPjxyZWYtdHlwZSBuYW1l

PSJKb3VybmFsIEFydGljbGUiPjE3PC9yZWYtdHlwZT48Y29udHJpYnV0b3JzPjxhdXRob3JzPjxh

dXRob3I+VGV1ZmVsLCBNLjwvYXV0aG9yPjxhdXRob3I+U2F1ZGVrLCBWLjwvYXV0aG9yPjxhdXRo

b3I+TGVkaWcsIEouIFAuPC9hdXRob3I+PGF1dGhvcj5CZXJuaGFyZHQsIEEuPC9hdXRob3I+PGF1

dGhvcj5Cb3VsYXJhbmQsIFMuPC9hdXRob3I+PGF1dGhvcj5DYXJyZWF1LCBBLjwvYXV0aG9yPjxh

dXRob3I+Q2Fpcm5zLCBOLiBKLjwvYXV0aG9yPjxhdXRob3I+Q2FydGVyLCBDLjwvYXV0aG9yPjxh

dXRob3I+Q293bGV5LCBELiBKLjwvYXV0aG9yPjxhdXRob3I+RHV2ZXJnZXIsIEQuPC9hdXRob3I+

PGF1dGhvcj5HYW56aG9ybiwgQS4gSi48L2F1dGhvcj48YXV0aG9yPkd1ZW5ldCwgQy48L2F1dGhv

cj48YXV0aG9yPkhlaW50emVsbWFubiwgQi48L2F1dGhvcj48YXV0aG9yPkxhdWNoZXIsIFYuPC9h

dXRob3I+PGF1dGhvcj5TYXV2YWdlLCBDLjwvYXV0aG9yPjxhdXRob3I+U21pcm5vdmEsIFQuPC9h

dXRob3I+PC9hdXRob3JzPjwvY29udHJpYnV0b3JzPjxhdXRoLWFkZHJlc3M+RGVwYXJ0bWVudCBv

ZiBFeHBsb3JhdG9yeSBSZXNlYXJjaCwgU2Fub2ZpIFN5bnRoZWxhYm8gUmVjaGVyY2hlLCAxNiBS

dWUgZCZhcG9zO0Fua2FyYSwgRi02NzA4MCBTdHJhc2JvdXJnLCBGcmFuY2UuIG1pY2hhZWwudGV1

ZmVsQHNhbm9maS1zeW50aGVsYWJvLmNvbTwvYXV0aC1hZGRyZXNzPjx0aXRsZXM+PHRpdGxlPlNl

cXVlbmNlIGlkZW50aWZpY2F0aW9uIGFuZCBjaGFyYWN0ZXJpemF0aW9uIG9mIGh1bWFuIGNhcm5v

c2luYXNlIGFuZCBhIGNsb3NlbHkgcmVsYXRlZCBub24tc3BlY2lmaWMgZGlwZXB0aWRhc2U8L3Rp

dGxlPjxzZWNvbmRhcnktdGl0bGU+SiBCaW9sIENoZW08L3NlY29uZGFyeS10aXRsZT48YWx0LXRp

dGxlPlRoZSBKb3VybmFsIG9mIGJpb2xvZ2ljYWwgY2hlbWlzdHJ5PC9hbHQtdGl0bGU+PC90aXRs

ZXM+PHBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+SiBCaW9sIENoZW08L2Z1bGwtdGl0bGU+PGFiYnIt

MT5UaGUgSm91cm5hbCBvZiBiaW9sb2dpY2FsIGNoZW1pc3RyeTwvYWJici0xPjwvcGVyaW9kaWNh

bD48YWx0LXBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+SiBCaW9sIENoZW08L2Z1bGwtdGl0bGU+PGFi

YnItMT5UaGUgSm91cm5hbCBvZiBiaW9sb2dpY2FsIGNoZW1pc3RyeTwvYWJici0xPjwvYWx0LXBl

cmlvZGljYWw+PHBhZ2VzPjY1MjEtMzE8L3BhZ2VzPjx2b2x1bWU+Mjc4PC92b2x1bWU+PG51bWJl

cj44PC9udW1iZXI+PGVkaXRpb24+MjAwMi8xMi8xMTwvZWRpdGlvbj48a2V5d29yZHM+PGtleXdv

cmQ+QW1pbm8gQWNpZCBTZXF1ZW5jZTwva2V5d29yZD48a2V5d29yZD5CYXNlIFNlcXVlbmNlPC9r

ZXl3b3JkPjxrZXl3b3JkPkJyYWluL2Vuenltb2xvZ3k8L2tleXdvcmQ+PGtleXdvcmQ+Q2xvbmlu

ZywgTW9sZWN1bGFyPC9rZXl3b3JkPjxrZXl3b3JkPkRpcGVwdGlkYXNlcy8gY2hlbWlzdHJ5LyBn

ZW5ldGljcy9tZXRhYm9saXNtPC9rZXl3b3JkPjxrZXl3b3JkPkV4cHJlc3NlZCBTZXF1ZW5jZSBU

YWdzPC9rZXl3b3JkPjxrZXl3b3JkPkdlbmV0aWMgVmVjdG9yczwva2V5d29yZD48a2V5d29yZD5I

dW1hbnM8L2tleXdvcmQ+PGtleXdvcmQ+SW1tdW5vaGlzdG9jaGVtaXN0cnk8L2tleXdvcmQ+PGtl

eXdvcmQ+S2luZXRpY3M8L2tleXdvcmQ+PGtleXdvcmQ+TW9sZWN1bGFyIFNlcXVlbmNlIERhdGE8

L2tleXdvcmQ+PGtleXdvcmQ+TXV0YWdlbmVzaXMsIFNpdGUtRGlyZWN0ZWQ8L2tleXdvcmQ+PGtl

eXdvcmQ+UHNldWRvbW9uYXMvZW56eW1vbG9neTwva2V5d29yZD48a2V5d29yZD5SZWNvbWJpbmFu

dCBQcm90ZWlucy9jaGVtaXN0cnk8L2tleXdvcmQ+PGtleXdvcmQ+U2VxdWVuY2UgQWxpZ25tZW50

PC9rZXl3b3JkPjxrZXl3b3JkPlNlcXVlbmNlIEhvbW9sb2d5LCBBbWlubyBBY2lkPC9rZXl3b3Jk

PjxrZXl3b3JkPlN1YnN0cmF0ZSBTcGVjaWZpY2l0eTwva2V5d29yZD48a2V5d29yZD5nYW1tYS1H

bHV0YW15bCBIeWRyb2xhc2U8L2tleXdvcmQ+PC9rZXl3b3Jkcz48ZGF0ZXM+PHllYXI+MjAwMzwv

eWVhcj48cHViLWRhdGVzPjxkYXRlPkZlYiAyMTwvZGF0ZT48L3B1Yi1kYXRlcz48L2RhdGVzPjxp

c2JuPjAwMjEtOTI1OCAoUHJpbnQpJiN4RDswMDIxLTkyNTggKExpbmtpbmcpPC9pc2JuPjxhY2Nl

c3Npb24tbnVtPjEyNDczNjc2PC9hY2Nlc3Npb24tbnVtPjx1cmxzPjwvdXJscz48ZWxlY3Ryb25p

Yy1yZXNvdXJjZS1udW0+MTAuMTA3NC9qYmMuTTIwOTc2NDIwMDwvZWxlY3Ryb25pYy1yZXNvdXJj

ZS1udW0+PHJlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj5OTE08L3JlbW90ZS1kYXRhYmFzZS1wcm92

aWRlcj48bGFuZ3VhZ2U+ZW5nPC9sYW5ndWFnZT48L3JlY29yZD48L0NpdGU+PC9FbmROb3RlPn==

ADDIN EN.CITE PEVuZE5vdGU+PENpdGU+PEF1dGhvcj5MZW5uZXk8L0F1dGhvcj48WWVhcj4xOTgyPC9ZZWFyPjxS

ZWNOdW0+ODk8L1JlY051bT48RGlzcGxheVRleHQ+WzksIDE5NV08L0Rpc3BsYXlUZXh0PjxyZWNv

cmQ+PHJlYy1udW1iZXI+ODk8L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5IGFwcD0iRU4i

IGRiLWlkPSJ3MndmeGFmZTZ2YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjg5PC9rZXk+PC9m

b3JlaWduLWtleXM+PHJlZi10eXBlIG5hbWU9IkpvdXJuYWwgQXJ0aWNsZSI+MTc8L3JlZi10eXBl

Pjxjb250cmlidXRvcnM+PGF1dGhvcnM+PGF1dGhvcj5MZW5uZXksIEouIEYuPC9hdXRob3I+PGF1

dGhvcj5HZW9yZ2UsIFIuIFAuPC9hdXRob3I+PGF1dGhvcj5XZWlzcywgQS4gTS48L2F1dGhvcj48

YXV0aG9yPkt1Y2VyYSwgQy4gTS48L2F1dGhvcj48YXV0aG9yPkNoYW4sIFAuIFcuPC9hdXRob3I+

PGF1dGhvcj5SaW56bGVyLCBHLiBTLjwvYXV0aG9yPjwvYXV0aG9ycz48L2NvbnRyaWJ1dG9ycz48

dGl0bGVzPjx0aXRsZT5IdW1hbiBzZXJ1bSBjYXJub3NpbmFzZTogY2hhcmFjdGVyaXphdGlvbiwg

ZGlzdGluY3Rpb24gZnJvbSBjZWxsdWxhciBjYXJub3NpbmFzZSwgYW5kIGFjdGl2YXRpb24gYnkg

Y2FkbWl1bTwvdGl0bGU+PHNlY29uZGFyeS10aXRsZT5DbGluIENoaW0gQWN0YTwvc2Vjb25kYXJ5

LXRpdGxlPjxhbHQtdGl0bGU+Q2xpbmljYSBjaGltaWNhIGFjdGE7IGludGVybmF0aW9uYWwgam91

cm5hbCBvZiBjbGluaWNhbCBjaGVtaXN0cnk8L2FsdC10aXRsZT48L3RpdGxlcz48cGVyaW9kaWNh

bD48ZnVsbC10aXRsZT5DbGluIENoaW0gQWN0YTwvZnVsbC10aXRsZT48YWJici0xPkNsaW5pY2Eg

Y2hpbWljYSBhY3RhOyBpbnRlcm5hdGlvbmFsIGpvdXJuYWwgb2YgY2xpbmljYWwgY2hlbWlzdHJ5

PC9hYmJyLTE+PC9wZXJpb2RpY2FsPjxhbHQtcGVyaW9kaWNhbD48ZnVsbC10aXRsZT5DbGluIENo

aW0gQWN0YTwvZnVsbC10aXRsZT48YWJici0xPkNsaW5pY2EgY2hpbWljYSBhY3RhOyBpbnRlcm5h

dGlvbmFsIGpvdXJuYWwgb2YgY2xpbmljYWwgY2hlbWlzdHJ5PC9hYmJyLTE+PC9hbHQtcGVyaW9k

aWNhbD48cGFnZXM+MjIxLTMxPC9wYWdlcz48dm9sdW1lPjEyMzwvdm9sdW1lPjxudW1iZXI+Mzwv

bnVtYmVyPjxlZGl0aW9uPjE5ODIvMDgvMTg8L2VkaXRpb24+PGtleXdvcmRzPjxrZXl3b3JkPkFk

b2xlc2NlbnQ8L2tleXdvcmQ+PGtleXdvcmQ+QWR1bHQ8L2tleXdvcmQ+PGtleXdvcmQ+QWdlZDwv

a2V5d29yZD48a2V5d29yZD5BZ2luZzwva2V5d29yZD48a2V5d29yZD5DYWRtaXVtLyBibG9vZDwv

a2V5d29yZD48a2V5d29yZD5DYXJub3NpbmUvYW5hbG9ncyAmYW1wOyBkZXJpdmF0aXZlcy9tZXRh

Ym9saXNtPC9rZXl3b3JkPjxrZXl3b3JkPkNoaWxkPC9rZXl3b3JkPjxrZXl3b3JkPkNoaWxkLCBQ

cmVzY2hvb2w8L2tleXdvcmQ+PGtleXdvcmQ+RGlwZXB0aWRhc2VzLyBibG9vZDwva2V5d29yZD48

a2V5d29yZD5Fbnp5bWUgQWN0aXZhdGlvbi9kcnVnIGVmZmVjdHM8L2tleXdvcmQ+PGtleXdvcmQ+

SHVtYW5zPC9rZXl3b3JkPjxrZXl3b3JkPkluZmFudDwva2V5d29yZD48a2V5d29yZD5Jc29lbGVj

dHJpYyBQb2ludDwva2V5d29yZD48a2V5d29yZD5Jc29lbnp5bWVzLyBibG9vZDwva2V5d29yZD48

a2V5d29yZD5LaW5ldGljczwva2V5d29yZD48a2V5d29yZD5NaWRkbGUgQWdlZDwva2V5d29yZD48

a2V5d29yZD5Nb2xlY3VsYXIgV2VpZ2h0PC9rZXl3b3JkPjxrZXl3b3JkPlN1YnN0cmF0ZSBTcGVj

aWZpY2l0eTwva2V5d29yZD48L2tleXdvcmRzPjxkYXRlcz48eWVhcj4xOTgyPC95ZWFyPjxwdWIt

ZGF0ZXM+PGRhdGU+QXVnIDE4PC9kYXRlPjwvcHViLWRhdGVzPjwvZGF0ZXM+PGlzYm4+MDAwOS04

OTgxIChQcmludCkmI3hEOzAwMDktODk4MSAoTGlua2luZyk8L2lzYm4+PGFjY2Vzc2lvbi1udW0+

NzExNjY0NDwvYWNjZXNzaW9uLW51bT48dXJscz48L3VybHM+PHJlbW90ZS1kYXRhYmFzZS1wcm92

aWRlcj5OTE08L3JlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj48bGFuZ3VhZ2U+ZW5nPC9sYW5ndWFn

ZT48L3JlY29yZD48L0NpdGU+PENpdGU+PEF1dGhvcj5UZXVmZWw8L0F1dGhvcj48WWVhcj4yMDAz

PC9ZZWFyPjxSZWNOdW0+OTk8L1JlY051bT48cmVjb3JkPjxyZWMtbnVtYmVyPjk5PC9yZWMtbnVt

YmVyPjxmb3JlaWduLWtleXM+PGtleSBhcHA9IkVOIiBkYi1pZD0idzJ3ZnhhZmU2dmE5ejVlZXYy

bDU1YWE4c3hzYTU5OWVldjJzIj45OTwva2V5PjwvZm9yZWlnbi1rZXlzPjxyZWYtdHlwZSBuYW1l

PSJKb3VybmFsIEFydGljbGUiPjE3PC9yZWYtdHlwZT48Y29udHJpYnV0b3JzPjxhdXRob3JzPjxh

dXRob3I+VGV1ZmVsLCBNLjwvYXV0aG9yPjxhdXRob3I+U2F1ZGVrLCBWLjwvYXV0aG9yPjxhdXRo

b3I+TGVkaWcsIEouIFAuPC9hdXRob3I+PGF1dGhvcj5CZXJuaGFyZHQsIEEuPC9hdXRob3I+PGF1

dGhvcj5Cb3VsYXJhbmQsIFMuPC9hdXRob3I+PGF1dGhvcj5DYXJyZWF1LCBBLjwvYXV0aG9yPjxh

dXRob3I+Q2Fpcm5zLCBOLiBKLjwvYXV0aG9yPjxhdXRob3I+Q2FydGVyLCBDLjwvYXV0aG9yPjxh

dXRob3I+Q293bGV5LCBELiBKLjwvYXV0aG9yPjxhdXRob3I+RHV2ZXJnZXIsIEQuPC9hdXRob3I+

PGF1dGhvcj5HYW56aG9ybiwgQS4gSi48L2F1dGhvcj48YXV0aG9yPkd1ZW5ldCwgQy48L2F1dGhv

cj48YXV0aG9yPkhlaW50emVsbWFubiwgQi48L2F1dGhvcj48YXV0aG9yPkxhdWNoZXIsIFYuPC9h

dXRob3I+PGF1dGhvcj5TYXV2YWdlLCBDLjwvYXV0aG9yPjxhdXRob3I+U21pcm5vdmEsIFQuPC9h

dXRob3I+PC9hdXRob3JzPjwvY29udHJpYnV0b3JzPjxhdXRoLWFkZHJlc3M+RGVwYXJ0bWVudCBv

ZiBFeHBsb3JhdG9yeSBSZXNlYXJjaCwgU2Fub2ZpIFN5bnRoZWxhYm8gUmVjaGVyY2hlLCAxNiBS

dWUgZCZhcG9zO0Fua2FyYSwgRi02NzA4MCBTdHJhc2JvdXJnLCBGcmFuY2UuIG1pY2hhZWwudGV1

ZmVsQHNhbm9maS1zeW50aGVsYWJvLmNvbTwvYXV0aC1hZGRyZXNzPjx0aXRsZXM+PHRpdGxlPlNl

cXVlbmNlIGlkZW50aWZpY2F0aW9uIGFuZCBjaGFyYWN0ZXJpemF0aW9uIG9mIGh1bWFuIGNhcm5v

c2luYXNlIGFuZCBhIGNsb3NlbHkgcmVsYXRlZCBub24tc3BlY2lmaWMgZGlwZXB0aWRhc2U8L3Rp

dGxlPjxzZWNvbmRhcnktdGl0bGU+SiBCaW9sIENoZW08L3NlY29uZGFyeS10aXRsZT48YWx0LXRp

dGxlPlRoZSBKb3VybmFsIG9mIGJpb2xvZ2ljYWwgY2hlbWlzdHJ5PC9hbHQtdGl0bGU+PC90aXRs

ZXM+PHBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+SiBCaW9sIENoZW08L2Z1bGwtdGl0bGU+PGFiYnIt

MT5UaGUgSm91cm5hbCBvZiBiaW9sb2dpY2FsIGNoZW1pc3RyeTwvYWJici0xPjwvcGVyaW9kaWNh

bD48YWx0LXBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+SiBCaW9sIENoZW08L2Z1bGwtdGl0bGU+PGFi

YnItMT5UaGUgSm91cm5hbCBvZiBiaW9sb2dpY2FsIGNoZW1pc3RyeTwvYWJici0xPjwvYWx0LXBl

cmlvZGljYWw+PHBhZ2VzPjY1MjEtMzE8L3BhZ2VzPjx2b2x1bWU+Mjc4PC92b2x1bWU+PG51bWJl

cj44PC9udW1iZXI+PGVkaXRpb24+MjAwMi8xMi8xMTwvZWRpdGlvbj48a2V5d29yZHM+PGtleXdv

cmQ+QW1pbm8gQWNpZCBTZXF1ZW5jZTwva2V5d29yZD48a2V5d29yZD5CYXNlIFNlcXVlbmNlPC9r

ZXl3b3JkPjxrZXl3b3JkPkJyYWluL2Vuenltb2xvZ3k8L2tleXdvcmQ+PGtleXdvcmQ+Q2xvbmlu

ZywgTW9sZWN1bGFyPC9rZXl3b3JkPjxrZXl3b3JkPkRpcGVwdGlkYXNlcy8gY2hlbWlzdHJ5LyBn

ZW5ldGljcy9tZXRhYm9saXNtPC9rZXl3b3JkPjxrZXl3b3JkPkV4cHJlc3NlZCBTZXF1ZW5jZSBU

YWdzPC9rZXl3b3JkPjxrZXl3b3JkPkdlbmV0aWMgVmVjdG9yczwva2V5d29yZD48a2V5d29yZD5I

dW1hbnM8L2tleXdvcmQ+PGtleXdvcmQ+SW1tdW5vaGlzdG9jaGVtaXN0cnk8L2tleXdvcmQ+PGtl

eXdvcmQ+S2luZXRpY3M8L2tleXdvcmQ+PGtleXdvcmQ+TW9sZWN1bGFyIFNlcXVlbmNlIERhdGE8

L2tleXdvcmQ+PGtleXdvcmQ+TXV0YWdlbmVzaXMsIFNpdGUtRGlyZWN0ZWQ8L2tleXdvcmQ+PGtl

eXdvcmQ+UHNldWRvbW9uYXMvZW56eW1vbG9neTwva2V5d29yZD48a2V5d29yZD5SZWNvbWJpbmFu

dCBQcm90ZWlucy9jaGVtaXN0cnk8L2tleXdvcmQ+PGtleXdvcmQ+U2VxdWVuY2UgQWxpZ25tZW50

PC9rZXl3b3JkPjxrZXl3b3JkPlNlcXVlbmNlIEhvbW9sb2d5LCBBbWlubyBBY2lkPC9rZXl3b3Jk

PjxrZXl3b3JkPlN1YnN0cmF0ZSBTcGVjaWZpY2l0eTwva2V5d29yZD48a2V5d29yZD5nYW1tYS1H

bHV0YW15bCBIeWRyb2xhc2U8L2tleXdvcmQ+PC9rZXl3b3Jkcz48ZGF0ZXM+PHllYXI+MjAwMzwv

eWVhcj48cHViLWRhdGVzPjxkYXRlPkZlYiAyMTwvZGF0ZT48L3B1Yi1kYXRlcz48L2RhdGVzPjxp

c2JuPjAwMjEtOTI1OCAoUHJpbnQpJiN4RDswMDIxLTkyNTggKExpbmtpbmcpPC9pc2JuPjxhY2Nl

c3Npb24tbnVtPjEyNDczNjc2PC9hY2Nlc3Npb24tbnVtPjx1cmxzPjwvdXJscz48ZWxlY3Ryb25p

Yy1yZXNvdXJjZS1udW0+MTAuMTA3NC9qYmMuTTIwOTc2NDIwMDwvZWxlY3Ryb25pYy1yZXNvdXJj

ZS1udW0+PHJlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj5OTE08L3JlbW90ZS1kYXRhYmFzZS1wcm92

aWRlcj48bGFuZ3VhZ2U+ZW5nPC9sYW5ndWFnZT48L3JlY29yZD48L0NpdGU+PC9FbmROb3RlPn==

ADDIN EN.CITE.DATA [9, 195].

Рисунок 3.2.

2. Избирательность действия карнозина сочеталась с различиями в уровнях мРНК карнозин-синтезирующих (А) и карнозин-разрушающих (Б) ферментов в исследуемых клеточных культурах. Результаты ПЦР в реальном времени. Звездочка обозначает статистически значимое отличие от уровня мРНК в клетках U-118-MG; n=3, p<0.05.

На Рис 3.2.

2. представлены результаты измерения экспрессии генов карнозин-синтетазы и карнозиназы в исследуемых клеточных линиях, с помощью метода ПЦР в реальном времени. Из Рис. 3.2.2. видно, что в клетках U-118-MG уровень мРНК карнозин-синтазы был в 3,5 - 5 раз ниже, чем в клетках карцином (Рис. 3.2.2.А), а уровень мРНК карнозиназы, наоборот, был 4 - 6 раз выше (Рис. 3.2.2.Б). На основании этих данных можно предположить, что уровень эндогенного карнозина в клетках глиобластомы изначально ниже, чем в клетках карцином. Изначально низкий уровень карнозина в клетках глиобластомы, вероятно, обуславливает их большую чувствительность к антипролиферативному эффекту карнозина, в то время как высокий уровень карнозина в клетках карцином способствует развитию в них толерантности рост-ингибирующему действию карнозина. Поскольку наиболее выраженный антипролиферативный эффект карнозина был получен на клетках глиобластомы человека U-118-MG, эти клетки были использованы в дальнейших исследованиях.

Для более подробного изучения антипролифативного действия карнозина, клетки U-118-MG инкубировали в среде, в которую добавляли 20-100 мМ карнозина и измеряли Td. На Рис. 3.2.3. представлены результаты подробного анализа влияния карнозина на пролиферацию клеток глиобластомы. Было выяснено, что карнозин приводит к дозо-зависимому увеличению Td клеток U-118-MG, что согласовывалось с полученными ранее данными (Рис. 3.2.1). Td в контроле составляло 35 ч, в присутствии 50 мМ карнозина Td снижалось до 66 ч. Пролиферация была полностью подавлена в пробах обработанных 80 мМ и 100 мМ карнозина (Рис. 3.2.3.А).

Ингибирующий эффект карнозина на пролиферацию клеток U-118-MG был подтвержден результатами измерения способностей клеток формировать колонии, то есть делиться. Результаты анализа выживаемости представлены на Рис. 3.2.3.Б. Из полученных дынных видно, что инкубация клеток глиобластомы с карнозином (50 - 100 мМ) в течение 24 ч приводила к снижению их выживаемости. Выживаемость клеток U-118-MG, обработанных 100 мМ карнозина, снижалась до 60% по сравнению с контролем (Рис. 3.2.3.Б).

Рисунок 3.2.

3. Карнозин дозо-зависимо подавляет пролиферацию клеток глиобластомы. (А) Кривые роста клеток U-118-MG в контроле и при добавлении к среде культивирования 20 – 100 мМ карнозина. Td рассчитывали, как описано на Рис. 3.2.1. Звездочка обозначает статистически значимое отличие от количества клеток в контроле; n=3, p<0.05. (Б) Выживаемость клеток оценивали по способности формировать колонии. Звездочка обозначает статистически значимое отличие от выживаемости в контроле; n=3, p<0.05.

Исходя из полученных данных, был сделан вывод о том, что карнозин оказывает ингибирующее действие на пролиферацию клеток глиобластомы (U-118-MG), карциномы горла и рта (FaDu, Cal27) и молочной железы (MB231). Наиболее выраженный эффект наблюдали в клетках глиобластомы. Избирательность действия карнозина может быть связана с пониженным уровнем экспрессии карнозин-синтетазы и повышенным уровнем экспрессии карнозиназы в клетках глиобластомы по сравнению с клетками карцином.

3.2.2. Карнозин снижает уровень АФК и индуцирует экспрессию MnСОДАФК принимают активное участие в регуляции клеточной пролиферации. Изменения внутриклеточного уровня АФК часто приводит к нарушениям пролиферативных процессов PEVuZE5vdGU+PENpdGU+PEF1dGhvcj5ZYW1hdWNoaTwvQXV0aG9yPjxZZWFyPjE5OTc8L1llYXI+

PFJlY051bT4zMjI8L1JlY051bT48RGlzcGxheVRleHQ+WzI0LCAyNSwgNjcsIDE3NF08L0Rpc3Bs

YXlUZXh0PjxyZWNvcmQ+PHJlYy1udW1iZXI+MzIyPC9yZWMtbnVtYmVyPjxmb3JlaWduLWtleXM+

PGtleSBhcHA9IkVOIiBkYi1pZD0idzJ3ZnhhZmU2dmE5ejVlZXYybDU1YWE4c3hzYTU5OWVldjJz

Ij4zMjI8L2tleT48L2ZvcmVpZ24ta2V5cz48cmVmLXR5cGUgbmFtZT0iSm91cm5hbCBBcnRpY2xl

Ij4xNzwvcmVmLXR5cGU+PGNvbnRyaWJ1dG9ycz48YXV0aG9ycz48YXV0aG9yPllhbWF1Y2hpLCBB

LjwvYXV0aG9yPjxhdXRob3I+Qmxvb20sIEUuIFQuPC9hdXRob3I+PC9hdXRob3JzPjwvY29udHJp

YnV0b3JzPjxhdXRoLWFkZHJlc3M+Q2VudGVyIGZvciBCaW9sb2dpY3MgRXZhbHVhdGlvbiBhbmQg

UmVzZWFyY2gsIEZvb2QgYW5kIERydWcgQWRtaW5pc3RyYXRpb24sIEJldGhlc2RhLCBNRCAyMDg5

MiwgVVNBLjwvYXV0aC1hZGRyZXNzPjx0aXRsZXM+PHRpdGxlPkNvbnRyb2wgb2YgY2VsbCBjeWNs

ZSBwcm9ncmVzc2lvbiBpbiBodW1hbiBuYXR1cmFsIGtpbGxlciBjZWxscyB0aHJvdWdoIHJlZG94

IHJlZ3VsYXRpb24gb2YgZXhwcmVzc2lvbiBhbmQgcGhvc3Bob3J5bGF0aW9uIG9mIHJldGlub2Js

YXN0b21hIGdlbmUgcHJvZHVjdCBwcm90ZWluPC90aXRsZT48c2Vjb25kYXJ5LXRpdGxlPkJsb29k

PC9zZWNvbmRhcnktdGl0bGU+PGFsdC10aXRsZT5CbG9vZDwvYWx0LXRpdGxlPjwvdGl0bGVzPjxw

ZXJpb2RpY2FsPjxmdWxsLXRpdGxlPkJsb29kPC9mdWxsLXRpdGxlPjxhYmJyLTE+Qmxvb2Q8L2Fi

YnItMT48L3BlcmlvZGljYWw+PGFsdC1wZXJpb2RpY2FsPjxmdWxsLXRpdGxlPkJsb29kPC9mdWxs

LXRpdGxlPjxhYmJyLTE+Qmxvb2Q8L2FiYnItMT48L2FsdC1wZXJpb2RpY2FsPjxwYWdlcz40MDky

LTk8L3BhZ2VzPjx2b2x1bWU+ODk8L3ZvbHVtZT48bnVtYmVyPjExPC9udW1iZXI+PGVkaXRpb24+

MTk5Ny8wNi8wMTwvZWRpdGlvbj48a2V5d29yZHM+PGtleXdvcmQ+Q2VsbCBDeWNsZTwva2V5d29y

ZD48a2V5d29yZD5DZWxsIExpbmU8L2tleXdvcmQ+PGtleXdvcmQ+R2VuZSBFeHByZXNzaW9uIFJl

Z3VsYXRpb248L2tleXdvcmQ+PGtleXdvcmQ+SHVtYW5zPC9rZXl3b3JkPjxrZXl3b3JkPktpbGxl

ciBDZWxscywgTmF0dXJhbC8gY3l0b2xvZ3kvbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5P

eGlkYXRpb24tUmVkdWN0aW9uPC9rZXl3b3JkPjxrZXl3b3JkPlBob3NwaG9yeWxhdGlvbjwva2V5

d29yZD48a2V5d29yZD5SZXRpbm9ibGFzdG9tYSBQcm90ZWluLyBtZXRhYm9saXNtPC9rZXl3b3Jk

PjxrZXl3b3JkPlNpZ25hbCBUcmFuc2R1Y3Rpb248L2tleXdvcmQ+PC9rZXl3b3Jkcz48ZGF0ZXM+

PHllYXI+MTk5NzwveWVhcj48cHViLWRhdGVzPjxkYXRlPkp1biAxPC9kYXRlPjwvcHViLWRhdGVz

PjwvZGF0ZXM+PGlzYm4+MDAwNi00OTcxIChQcmludCkmI3hEOzAwMDYtNDk3MSAoTGlua2luZyk8

L2lzYm4+PGFjY2Vzc2lvbi1udW0+OTE2Njg1MDwvYWNjZXNzaW9uLW51bT48dXJscz48L3VybHM+

PHJlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj5OTE08L3JlbW90ZS1kYXRhYmFzZS1wcm92aWRlcj48

bGFuZ3VhZ2U+ZW5nPC9sYW5ndWFnZT48L3JlY29yZD48L0NpdGU+PENpdGU+PEF1dGhvcj5NZW5v

bjwvQXV0aG9yPjxZZWFyPjIwMDc8L1llYXI+PFJlY051bT4zMzwvUmVjTnVtPjxyZWNvcmQ+PHJl

Yy1udW1iZXI+MzM8L3JlYy1udW1iZXI+PGZvcmVpZ24ta2V5cz48a2V5IGFwcD0iRU4iIGRiLWlk

PSJ3MndmeGFmZTZ2YTl6NWVldjJsNTVhYThzeHNhNTk5ZWV2MnMiPjMzPC9rZXk+PC9mb3JlaWdu

LWtleXM+PHJlZi10eXBlIG5hbWU9IkpvdXJuYWwgQXJ0aWNsZSI+MTc8L3JlZi10eXBlPjxjb250

cmlidXRvcnM+PGF1dGhvcnM+PGF1dGhvcj5NZW5vbiwgUy4gRy48L2F1dGhvcj48YXV0aG9yPkdv

c3dhbWksIFAuIEMuPC9hdXRob3I+PC9hdXRob3JzPjwvY29udHJpYnV0b3JzPjxhdXRoLWFkZHJl

c3M+RnJlZSBSYWRpY2FsIGFuZCBSYWRpYXRpb24gQmlvbG9neSBQcm9ncmFtLCBEZXBhcnRtZW50

IG9mIFJhZGlhdGlvbiBPbmNvbG9neSwgVW5pdmVyc2l0eSBvZiBJb3dhLCBJb3dhIENpdHksIElB

IDUyMjQyLCBVU0EuPC9hdXRoLWFkZHJlc3M+PHRpdGxlcz48dGl0bGU+QSByZWRveCBjeWNsZSB3

aXRoaW4gdGhlIGNlbGwgY3ljbGU6IHJpbmcgaW4gdGhlIG9sZCB3aXRoIHRoZSBuZXc8L3RpdGxl

PjxzZWNvbmRhcnktdGl0bGU+T25jb2dlbmU8L3NlY29uZGFyeS10aXRsZT48YWx0LXRpdGxlPk9u

Y29nZW5lPC9hbHQtdGl0bGU+PC90aXRsZXM+PHBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+T25jb2dl

bmU8L2Z1bGwtdGl0bGU+PGFiYnItMT5PbmNvZ2VuZTwvYWJici0xPjwvcGVyaW9kaWNhbD48YWx0

LXBlcmlvZGljYWw+PGZ1bGwtdGl0bGU+T25jb2dlbmU8L2Z1bGwtdGl0bGU+PGFiYnItMT5PbmNv

Z2VuZTwvYWJici0xPjwvYWx0LXBlcmlvZGljYWw+PHBhZ2VzPjExMDEtOTwvcGFnZXM+PHZvbHVt

ZT4yNjwvdm9sdW1lPjxudW1iZXI+ODwvbnVtYmVyPjxlZGl0aW9uPjIwMDYvMDgvMjM8L2VkaXRp

b24+PGtleXdvcmRzPjxrZXl3b3JkPkNlbGwgQ3ljbGU8L2tleXdvcmQ+PGtleXdvcmQ+Q2VsbCBD

eWNsZSBQcm90ZWlucy8gbWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5DZWxsIFByb2xpZmVy

YXRpb248L2tleXdvcmQ+PGtleXdvcmQ+Q2VsbCBUcmFuc2Zvcm1hdGlvbiwgTmVvcGxhc3RpYy8g

bWV0YWJvbGlzbTwva2V5d29yZD48a2V5d29yZD5IdW1hbnM8L2tleXdvcmQ+PGtleXdvcmQ+TWl0

b3Npczwva2V5d29yZD48a2V5d29yZD5PeGlkYXRpb24tUmVkdWN0aW9uPC9rZXl3b3JkPjxrZXl3

b3JkPlJldGlub2JsYXN0b21hL21ldGFib2xpc208L2tleXdvcmQ+PC9rZXl3b3Jkcz48ZGF0ZXM+

PHllYXI+MjAwNzwveWVhcj48cHViLWRhdGVzPjxkYXRlPkZlYiAyMjwvZGF0ZT48L3B1Yi1kYXRl

cz48L2RhdGVzPjxpc2JuPjA5NTAtOTIzMiAoUHJpbnQpJiN4RDswOTUwLTkyMzIgKExpbmtpbmcp



Pages:     | 1 |   ...   | 12 | 13 || 15 | 16 |   ...   | 17 |
Похожие работы:

«МИНИСТЕРСТВО ПРИРОДНЫХ РЕСУРСОВ И ЭКОЛОГИИ РОССИЙСКОЙ ФЕДЕРАЦИИФЕДЕРАЛЬНАЯ СЛУЖБАПО ГИДРОМЕТЕОРОЛОГИИ И МОНИТОРИНГУ ОКРУЖАЮЩЕЙ СРЕДЫФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ УЧРЕЖДЕНИЕИНСТИТУТ ПРИКЛАДНОЙ ГЕОФИЗИКИ ИМЕНИ АКАДЕМИКА Е.К.ФЕДОРОВА (ФГБУ ИПГ) 07620000 СТАНДАРТ ПРЕДПРИЯТИЯ 013779500 ИОНО...»

«Колотикова Анна Михайловна Московский государственный университет имени М.В. Ломоносова Факультет иностранных языков и регионоведения e-mail: alucardy@list.ru Anna M. Kolotikova, Lomonosov Moscow State University Faculty of Foreign Languages and Area Studies e-mail: alucardy@list.ru Особенности англо-русс...»

«Челябинская область Муниципальное бюджетное учреждение "Центр методического и хозяйственного обеспечения" от 12.12.2012г. Аналитическая справка по итогам проведения школьн...»

«ЙЕЛ ЖЫНЫС АЗАЛАРЫНЫ ЖАСА БАЙЛАНЫСТЫ ЕРЕКШЕЛІКТЕРІНІ КЛИНИКАЛЫ АНАТОМИЯСЫ Ахмад Н.С., Сейфульдинова М.А., Акжолова Н.А. С.Ж. Асфендияров атындаы аза лтты Медицина университеті Жынысты жетілу кезеі (puberty (лат. "pubes" асаа) денені белгілі бір аймаыны тктенуі жретін кезе) адам міріндег...»

«Республиканское государственное казенное учреждение "Учебно – методический центр экологической безопасности и защиты населения" Методические рекомендации Безопасные весенние каникулы Йошкар-Ола 2015 № п/п Наименование учреждения телефон 1 Единая дежурно-дис...»

«Положение городского электрического транспорта в России С.С. Закиров, и.о. исполнительного директора МАП ГЭТ В.А. Матросов, генеральный директор ОАО "Рыбинскэлектротранс" Е.В. Матвеева, исполнительный редактор журнала "Техника железных дорог" На п...»

«ОАО "Центр благоустройства и обращения с отходами" _УТВЕРЖДАЮ Глава городского округа В.И. Хлыста "_"_ 2010г. ТО Роспотребнадзора в Саткинском районе _ "_"_ 2010г. ОТЧЕТ О НАУЧНО-ИССЛЕДОВАТЕЛЬСКОЙ РАБОТЕ ПО ТЕМЕ: ГЕНЕРАЛЬНАЯ СХЕМА ОЧИСТКИ ТЕРРИТОРИИ НАСЕЛЕННЫХ ПУНКТОВ Саткинского РАЙОНА ЧЕЛЯБИНСКОЙ ОБЛАСТИ Том 2...»

«Методические рекомендации по "Экологическим основам природопользования" Методические рекомендации разработаны с целью оказания методической помощи студентам для самостоятельной подготовки по экологическ...»

«Готовимся к олимпиаде по обществоведению ( II тур) 9 классI. Выберите правильный вариант ответа:1. Устойчивая общность людей, объединенная духовными традициями, сходным образом жизни, географическими и историческими рамками называется:а) цивилизацией, б) г...»

«ГЕОГРАФИЯ 10 класс естественно-математического направления (всего 68 ч, в неделю 2 ч) № Название темы Кол-во часов Основные цели обучения Результаты обучения Новые подходы и стратегии Формы и метод. вовлеч. уч-ся в уч....»

«Контрольная работа за 1 четверть1. Назовите имя учёного, проводившего в 1897 г. первую перепись населения России:а) Д.И. Менделеев; б) А.О. Ковалевский; в) П.Л. Чебышев; г) П.П. Семёнов-Тян-Шанский2. Какое место в мире по численности населения за...»

«Тема : Что нас окружает. Живая и неживая природа, изделия человека. Цель: сформировать у учащихся понятия о живом и неживом в природе и о рукотворном мире ; формировать умения классифицировать предметы; формировать навык соотнесения реального объекта и его условного обозначения ; сформировать начальное представление...»

«УТВЕРЖДАЮ: Т.И. Крикунова Директор МБОУ Хомутовской СОШ № 12 Расписание уроков 2014 2015 учебный год 1 смена День недели № урока Звонки 1 класс 2 класс 3 класс 4 класс 9 класс 11 класс Понедельник 1 8.00 – 8.40 Физическая культура Русский язык Математика Лите...»

«Н.Л. ГАЛЕЕВА, г. Москва, школа No 196 Развивающие и диагностические задания в курсе общей биологии // Биология, ПС, №24, 29-37, 2002 Доступность и наглядность объектов изучения долгое время обеспечивали школьной биологии ореол несложного предмета. Но уже с конца 1960-...»

«Урок 1 10 класс Тема урока Введение Цель Формирование знаний о медицинскойгеографии как науке о здоровье человека Задачи Обеспечить в ходе урока усвоение учащимися понятия медицинская география, предмет и методы ее исследования; Продолжить развитие у учащихся познавательного интереса, стремления к самостоятельному поиску зна...»

«Муниципальное бюджетное общеобразовательное учреждение средняя общеобразовательная школа с.Порез Унинского района Кировской области Имени Г.Ф.Шулятьева Проект "Цветочная клумба" дошкольные разновозрастные группы. 2013 г. Проект "Цветочная клумба" Цель проекта• Познакомить детей с цветами земли• Уч...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ ФГБОУ ВО Новосибирский национальный исследовательский государственный университет Факультет естественных наук УТВЕРЖДАЮ 75374540005 2306955106045Декан ФЕН НГУ, профессор _ Резников В.А. "_29_"_августа 2010 г. История России Учебно – методический комплекс...»

«Министерство образования и науки Российской Федерации Московский государственный гуманитарный университет имени М.А. Шолохова Выпускная квалификационная работа Студента 2 курса очного отделения факул...»

«Аннотация к рабочей программе "Технология. Технологии ведения дома", 5 класс Рабочая программа по технологии по направлению технологии ведение дома для учащихся 5 классов составлена в соответствии с Федеральным Государственным Образовательным Стандартом основного общего образования № 1897 от 17.12 2010г., пример...»

«Зачетная работа по теме "Мировое хозяйство" Часть А (На каждый вопрос – один правильный ответ) Что наиболее характерно для эпохи НТР? А. увеличение работающих в промышленности; Б. увеличение доли тяжелой промышленности в хозяйстве; В. увеличение доли растениеводства...»

«Министерство Российской Федерации по делам гражданской обороны, чрезвычайным ситуациям и ликвидации последствий стихийных бедствийУТВЕРЖДАЮ Заместитель Министра Российской Федерации по делам...»








 
2017 www.li.i-docx.ru - «Бесплатная электронная библиотека - различные ресурсы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.